Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 1% Penicillin/Streptomycin/L-Glutamate (P/S/G ...
-
bioRxiv - Cancer Biology 2024Quote: ... the tissues were stained with DAPI (4′,6-diamidino-2-phenylindole) for 5 minutes and mounted in ProLong™ Diamond Antifade Mountant (Thermo Fisher Scientific, MA, USA).
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in GFD medium supplemented with 5 mM L-glucose and 1 mM 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxy-D-glucose (2-NBDG; Invitrogen). Finally ...
-
bioRxiv - Cell Biology 2024Quote: Cells were transfected and 24h later treated with 250µM or 500µM of glucose fluorescent analogue 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (#N13195, Thermofisher) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
bioRxiv - Cell Biology 2024Quote: ... No mycoplasma were detected in cultures by 4′,6-diamidino-2-phenylindole (DAPI) or TO-PRO-3 (Thermo Fisher Scientific) staining ...
-
bioRxiv - Immunology 2024Quote: ... Sorted iNKT cells were cultured in cRPMI in 96-well plates that were previously coated for 12 h at 4 °C with 5 μg/mL of anti-CD3ε (clone 145-2C11, Invitrogen) in PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were lysed by adding 1:4 SDS buffer (2% SDS, EDTA) and samples were sonicated (5×1s pulses, 80% power, Fisher Scientific). Samples were diluted to 0.2% SDS with TX-100 lysis buffer and centrifuged for 20 min at 20,000 x g ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2020Quote: ... siRNA (4): s35234 and siRNA (5): s35235 (Silencer Select, ThermoFisher Scientific, USA); EMC2 s18670 and EMC5 s41131 (Silencer Select ...
-
bioRxiv - Immunology 2021Quote: ... 2.5-5 µg was loaded onto a NuPAGE 4-12% gel (ThermoFisher) and run at 100V for 2-3 h ...
-
bioRxiv - Bioengineering 2023Quote: Samples were loaded with 5 μM Fluo-4 AM (ThermoFisher Scientific, Germany) in CM for 30 min in a cell culture incubator (37 °C and humidified 5% CO2) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 ng/ml IL-4 (Thermo Fisher Scientific, Cat#14-8041-62) and 1 ng/ml TGF-β1 (Cell Signaling Technology ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... After 4-5 minutes 30 µM SCH-23390 (Fisher Scientific Cat#: 092550) in ACSF was applied for 1 minute ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and passaged every 4-5 days using StemPro Accutase (Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2024Quote: ... and incubated overnight at 4° C with 5 mM MANT-GDP (Invitrogen). Excess nucleotide was removed using a GE FPLC using a HighPrep 26/10 column into a buffer containing 20 mM HEPES (pH 8.0) ...
-
bioRxiv - Cell Biology 2024Quote: ... 4-5×106 cells were resuspended in 100 μL of DMEM (Invitrogen) and 4 μg of plasmid DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted in fresh DMEM for 4 h followed by fixation with 4% PFA (Thermo Fisher Scientific). To induce expression of the hGRAD and TRIM21 systems ...
-
bioRxiv - Neuroscience 2020Quote: ... were quantified in autaptic neuronal cultures using N-(3-triethylammoniumpropyl)-4-(4-(dibutyl amino) styryl) pyridinium dibromide (FM1-43, Thermo Fisher Scientific, Waltham, MA, USA), similarly as in our previous report (Kawano et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... a 1:1000 dilution of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride, Molecular Probes; D1306, Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... and Nuclear DNA was counterstained with 1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher). Alternatively ...
-
bioRxiv - Biophysics 2020Quote: ... Nuclei were detected by staining with 4’,6-diamidino-2-phenylindole (DAPI, 1:200, ThermoFisher Scientific, USA) for 10 minutes at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... sections were counterstained with 4’,6-diamidine-2’-phenylindole dihydrochloride (DAPI, D3571, Molecular Probes, dilution 1:1000), re-washed ...
-
bioRxiv - Neuroscience 2023Quote: ... cell nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, 1:5000 dilution) for 15 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... The slides were then incubated with 1 ug/ml of 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen) in 1xPBS for 20 min at RT ...
-
bioRxiv - Developmental Biology 2024Quote: ... Antibodies were used together with DAPI (4’,6-diamidino-2-phenylindole, Thermo Scientific, 62248, 1:1,000 dilution). NDE1 (Abnova ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were visualized with Hoechst (4′,6-diamidino-2-phenylindole) (DAPI) (Invitrogen; 3258, ICC/IHC 1:5,000).
-
bioRxiv - Physiology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI, ThermoFisher Scientific, Cat No. D1306). Images were taken using Zeiss 880 confocal microscopy and quantified by using Fiji/ImageJ86.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were centrifuged at 14,000g for 5 minutes at 4°C and electrophoresed on NuPAGE™ 4-12% Bis-Tris Polyacrylamide gels (Thermo Fisher) with NuPAGE™ MOPS running buffer (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...
-
bioRxiv - Bioengineering 2024Quote: ... The next day the membrane was washed three times with 5% milk and incubated for 4 hours at 4°C in an anti-rabbit secondary antibody (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2024Quote: ... for 2 h at 4°C and processed through Zeba spin desalting columns (ThermoFisher) to remove excess unbound biotin.
-
bioRxiv - Microbiology 2024Quote: ... for 2 h at 4°C and processed through Zeba spin desalting columns (ThermoFisher) to remove excess unbound biotin ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Microbiology 2022Quote: ... one volume of 4% Agarose Gel (Gibco, Life Technologies) was mixed by a three-volume of preheated IAV growth media to make the overlay gel liquid and kept at 37 ℃ water bath ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418 ...