Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Biochemistry 2022Quote: ... TCEP HCl (Tris (2-carboxy ethyl phosphine) hydrochloride) was purchased from Thermo Scientific. All salts for buffers and reagents were of research grade and high purity ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 propanol and ethyl acetate were obtained from Fisher Scientific (Pittsburgh, PA, USA). Blood plasm was collected with the VACUETTE® K2 DTA Blood Collection Tube.
-
bioRxiv - Biochemistry 2022Quote: ... 2 propanol and ethyl acetate were obtained from Fisher Scientific (Pittsburgh, PA, USA). Oral fluid Quantisal® extraction buffer and collection devices were obtained from Immunalysis Corporation (Pomona ...
-
bioRxiv - Microbiology 2022Quote: ... The F gene was PCR amplified using primers RSV F 5’ (5’GCAAGGATTCCTTCGTGAC3’) and RSV F 3’ (5’CACACCACGCCAGTAG3’) and Phusion High-Fidelity DNA Polymerase (Thermo Fisher Scientific). Sanger sequencing was performed by Elim Biosciences.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged every 2-3 days by washing with HBSS (Gibco, cat#14170), trypsinizing using 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MMT) was obtained from Thermo Fisher. Crystal violet was purchased from VWR ...
-
bioRxiv - Bioengineering 2020Quote: Nbs were diluted in a 2- or 3-fold series in Opti-MEM (Thermofisher). Each Nb dilution (110 μl ...
-
bioRxiv - Physiology 2021Quote: ... cells were fed every 2-3 days with DMEM + 10% FBS (Thermo fisher Scientific) until differentiation was complete at day 10.
-
bioRxiv - Immunology 2022Quote: ... The band are visualized with gel electrophoresis using 2-3% agarose (#16500500, Thermo Fisher) gel with SYBR Safe dye (#S33102 ...
-
bioRxiv - Neuroscience 2022Quote: ... Secondary antibody (2-3% serum, 0.4% PBST, 1:500 Invitrogen A11035, 1:500 DAPI) was applied and incubated for one hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2-3 sections were mounted on each Superfrost Plus slide (Thermo Fisher Scientific). All sections were air-dried at −20 ° C for 1 hour and afterwards stored at −80 ° C.
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin/EDTA (Gibco™, 25300062). Cell density was 5x 104 per well for the experiments in the μ-Slide (ibidi ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Genomics 2023Quote: ... use 10 μL for 2-3 ml of blood) or EDTA (0.5M EDTA, Gibco, cat ...
-
bioRxiv - Cell Biology 2023Quote: ... MCEC were split every 2-3 days using TrypLE express enzyme (GibcoTM, Thermo Scientific) for 5min at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... with media replenished every 2-3 days or passaged with TrypLE (Gibco catalog #1260421) at 60-80% confluence ...
-
bioRxiv - Bioengineering 2024Quote: ... with media replenished every 2-3 days or passaged with TrypLE (Gibco catalog #1260421).
-
bioRxiv - Molecular Biology 2024Quote: ... a 3:2 ratio of 0.5% (w/v) ORO in isopropanol (Fisher Scientific, USA): double distilled H2O (ddH2O ...
-
bioRxiv - Microbiology 2024Quote: These cell lines were subcultured every 2–3 days using 0.05% Trypsin/EDTA (Gibco). All cell lines were maintained in a humidified 37°C incubator supplied with 5% CO2.
-
bioRxiv - Bioengineering 2024Quote: ... and CellEvent™ caspase-3/7 green detection reagent (2 µM Thermo Fisher Scientific) for 1 h and then subjected to confocal microscopy imaging (Leica TCS SP8 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the cell layers are examined for cell morphology using a phase contrast microscope washed with media and then 10 uM of 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in the presence or absence of 100 nM insulin as the initiating step and incubated for 20 or 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... qPCR was performed on QuantStudio 3 and 5 Real-Time PCR Systems (Thermo Fisher Scientific) based on the following cycling parameters ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 mM EDTA) and settled for 3 min in a magnetic stand (Fisher scientific, #FERMR02). Beads were then resuspended in 1 volume of IP buffer and ready to use ...
-
bioRxiv - Molecular Biology 2022Quote: ... Grids were blotted for 3 - 5 s in a Vitrobot (Mark IV, Thermo Fisher Scientific) at 20 °C and 100% humidity ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2021Quote: ... 3×105 U2OS cells were incubated with 5 pmol siRNA using lipofectamine RNAiMAX (Thermo Fisher) in a 12-well tissue culture plate for 2hr ...
-
bioRxiv - Genomics 2021Quote: ... Erythrocytes were lysed by treatment with 3-5 mL ACK lysing buffer (Gibco, Cat#A1049201) for 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... London) were transiently transfected with the following antisense oligos: ROD1 (5′ GGAAUGAUAUUGAGCUGCUAACAAA 3′; ThermoFisher Scientific), TACC3 (5’ GAGCGGACCUGUAAAACUA 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... 3-5 mm skin biopsies were collected in Biopsy Collection Medium (RPMI 1460 [Thermo Fisher] with 1X Antibiotic-Antimycotic [Thermo Fisher]) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Add pre-mix chewing solution (5 μl 10xNEBbuffer2.1, 3 μl 100 mM DTT (ThermoFisher, A39255), 2 μl 100 mM ATP (ThermoFisher ...
-
bioRxiv - Microbiology 2024Quote: ... homogenized and placed in sterile 5 mL Eppendorf tubes containing 3 mL of RNAlater (ThermoFisher). The tubes were stored at -20°C upon our arrival in the laboratory ...
-
bioRxiv - Bioengineering 2024Quote: ... Red blood cells were lysed with ACK Lysing Buffer (Gibco, 3 ml for 5 min). The cells were counted and resuspended in RPMI-1640 medium (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... The neurons were then washed 3 times for 5 minutes with 1X DPBS (14080055, Gibco) containing 0.1% Tween ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Microbiology 2023Quote: ... FungiQuant-Prb (6FAM) 5′-TGGTGCATGGCCGTT-3′ (MGBNFQ) 57 and QuantStudio3 instrument (Applied Biosystems, CA, USA). We used the following qPCR conditions ...