Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 % dipalmitoyl PI(3)phosphate (PI(3)P diC16) (Life Technologies) and extruded to 400 nm using a polycarbonate filter and a hand extruder (Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2024Quote: ... human custom-made 3’UTR HEC1 siRNA (oligo #3, Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-pyridinemethanol (RI = 1.545, 3-PM, A10381, Thermo Fisher Scientific) were used to mix with the water-based SMLM buffer ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in Caco2 cells ...
-
bioRxiv - Immunology 2024Quote: Two million splenocytes in 200 μl PBS from WT-Foxp3YFPCre/YFPCre and Dgka-/-zf/f-Foxp3YFPCre/YFPCre mice were seeded into a U-bottom 96-well plate in the presence or absence of 100 μM 2-(N-(7-Nitrobenz-2-oxa-1, 3-diazol-4-yl) Amino)-2-Deoxyglucose (2-NBDG; Life Technologies). After incubation at 37°C with 5% CO2 for 30min ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA expression was analyzed based on 2-3 biological replicates each with 3 technical repeats using QuantStudio™ Design & Analysis Software (Thermo Fisher Scientific Inc.). The 18S-rRNA housekeeping gene was used as an internal reference gene ...
-
bioRxiv - Cell Biology 2020Quote: ... with single-cell passaging every 2-3 days using accutase (ThermoFisher Scientific A1110501) at split ratios between 1:5 and 1:12.
-
bioRxiv - Plant Biology 2020Quote: ... from 2-3 weeks old seedlings and 500ng was treated with DNaseI (Ambion) and used for reverse transcription ...
-
bioRxiv - Neuroscience 2021Quote: ... TRPA1−/− male mice were loaded with Fura-2 (3 μg/mL, Life Technologies) and pluronic acid (1:1 ...
-
bioRxiv - Immunology 2020Quote: ... cells were treated with 2 mM caspase-3/7 detection reagent (Fisher Scientific) for 30 min ...
-
bioRxiv - Bioengineering 2021Quote: ... were all purchased from Sigma and MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium was purchased from Thermofisher.
-
bioRxiv - Biochemistry 2020Quote: ... and cells were loaded with 3 μM Fura-2 AM dye (Molecular Probes) in sterile-filtered HEPES-Tyrode Buffer (HTB ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary cells were loaded with Fura-2 AM (3 μM; Invitrogen/ThermoFisher Scientific) for 45 min at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary cells were loaded with Fura-2 AM (3 μM; Invitrogen/ThermoFisher Scientific) for 45 min at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... p97 siRNAs (2-HSS111263 and 3-HSS111264) were from Invitrogen (Thermo Fisher Scientific). p97 rescue constructs were previously published 53 and were resistant to siRNA # 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Calu-3 and Caco-2 cells were cultured in minimum essential medium (GIBCO) while A549-ACE2 cells were maintained in DMEM/F-12 medium (GIBCO) ...
-
HNRNPA2B1 controls an unfolded protein response-related prognostic gene signature in prostate cancerbioRxiv - Cancer Biology 2022Quote: ... (3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide) (MTT) (M6494, Thermo Fisher Scientific) was added to each well to a final concentration of 0.67 mg/ml and incubated at 37oC ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin-EDTA (Gibco, 25300062). These cells were cultured in Knockout™ D-MEM (Gibco ...
-
bioRxiv - Genomics 2024Quote: ... Cells were passaged every 2-3 days using 0.25% trypsin-EDTA (#25200056, Gibco) to keep them below 80% confluency ...
-
bioRxiv - Genetics 2023Quote: ... each coverslip was incubated in 3 μl fura-2 acetoxymethyl (AM) ester (Invitrogen) in 1X HBSS containing 5 mg/ml BSA (Sigma- Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were passaged every 2-3 days using TryplLE™ express enzyme (GIBCO) and trypsin inhibitor (GIBCO).
-
bioRxiv - Bioengineering 2023Quote: ... To this mixture we added glycerol 2-phosphate (3 M, Thermo Fisher Scientific) and (GT)15-SWCNTs (3.75 mg/L ...
-
bioRxiv - Cancer Biology 2023Quote: ... Capan-2 and BxPC-3 cell lines were cultured in RPMI medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet resuspended in 2-3 mL of TrypLE Express (Gibco # 12605010) for 15-20 min at 37°C to dissociate the organoids into single cells ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet resuspended in 2-3 mL of TrypLE Express (Gibco # 12605010) for 12 min at 37°C to keep the LPC spheroids as aggregates ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific). Images were captured automatically every two hours for 48 hours using the IncuCyte™ S3 Live-Cell Analysis Instrument (Essen BioScience) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following 3 days of selection with 2 µg/ml puromycin (Gibco, A11138-03), reference samples were collected (t=0 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for 2-3 hours at room temperature and incubated with Hoechst 33342 (Invitrogen) for 10 min at room temperature ...