Labshake search
Citations for Thermo Fisher :
5051 - 5100 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... cDNA was synthesized from the purified RNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific).
-
bioRxiv - Evolutionary Biology 2024Quote: ... cDNA was synthesized from the extracted RNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Dsx ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized from purified RNA using the High Capacity cDNA Reverse Transcription kit (Cat# 4368814) from ThermoFisher. Real time quantitative PCR was performed with primers GCTGAGTCCGCAGCAGG and CAGGGTCCAACTTGTCCAGAAT (spliced XBP1) ...
-
bioRxiv - Plant Biology 2024Quote: ... For cDNA synthesis 1 µg RNA was used with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Relative expression of target genes was quantified by RT-qPCR (95 °C 3 min ...
-
Aberrant regulation of serine metabolism drives extracellular vesicle release and cancer progressionbioRxiv - Cancer Biology 2024Quote: ... complementary DNA was generated from total RNA using a High Capacity cDNA Reverse Transcription Kit (4368814, Applied Biosystems). Total RNA was reverse transcribed using a TaqMan miRNA Reverse Transcription Kit from Applied Biosystems for the measurement of miR-891b expression (4366597 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptide mix was then fractionated using the Pierce High pH Reversed-Phase Peptide Fractionation Kit (ThermoFisher Scientific). The 8 obtained fractions were analyzed by online nanoliquid chromatography coupled to MS/MS (Ultimate 3000 RSLCnano and Q-Exactive HF ...
-
bioRxiv - Immunology 2024Quote: ... RNA was reverse-transcribed to cDNA using high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA). Then we used Taqman Master Mix (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... Tandem Mass Tags (TMT 10-plex) kits and microBCA protein assay kit were purchased from Thermo Fisher Scientific (Rockford ...
-
bioRxiv - Cancer Biology 2021Quote: ... Membranes were developed with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher SCIENTIFIC, Cat #34095). Antibodies were used at the following dilutions ...
-
bioRxiv - Systems Biology 2020Quote: ... Western Blots were developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher).
-
bioRxiv - Immunology 2021Quote: ... The reaction was developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermofisher Scientific) and imaged using ChemiDoc Touch Gel Imaging System (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... The reaction was developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermofisher Scientific) and imaged using ChemiDoc Touch Gel Imaging System (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... Membrane was coated with 750 μL SuperSignal™ West Maximum Sensitivity Substrate (Thermo Scientific) and imaged on the ChemiDoc™ Imaging System (Bio-Rad).
-
bioRxiv - Cell Biology 2022Quote: ... the membrane was treated with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific) and exposed on the Amersham Imager 600 (GE healthcare).
-
bioRxiv - Bioengineering 2019Quote: ... then developed by SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific, 34095).
-
bioRxiv - Developmental Biology 2019Quote: ... Immunoblots were developed using SuperSignalTM West Pico/Femto Sensitivity substrate (Thermo Scientific #34080, #34095) and a Konica Minolta SRX-101A medical film processor ...
-
bioRxiv - Cancer Biology 2019Quote: ... Protein signal was detected with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific).
-
bioRxiv - Biophysics 2019Quote: ... and detected with SuperSignal™ West Femto Maximum Sensitivity Substrate (Life Technologies, Cat# 34095) with Biorad ChemiDoc™ XRS+ system.
-
bioRxiv - Microbiology 2019Quote: ... Immunoreactive bands were developed by SuperSignal™ West Femto Maximum Sensitivity substrate (ThermoFisher Scientific). Image gel and membrane acquisition was carried out with ChemiDoc XRS (Bio-Rad).
-
bioRxiv - Developmental Biology 2019Quote: ... Immunoblots were developed using SuperSignal™West Pico/Femto Sensitivity substrate (Thermo Fisher Scientific) and developed using a Konica Minolta SRX-101A medical film processor (Wayne ...
-
bioRxiv - Neuroscience 2020Quote: ... Bands were detected with SuperSignal™ West Femto Maximum Sensitivity Substrate (#34095, ThermoFisher Scientific) and analysed using the ChemiDoc™ MP (BIO-RAD) ...
-
bioRxiv - Plant Biology 2021Quote: ... or 1/5 SuperSignal™ West Femto Maximum Sensitivity Substrate (34095, Thermo Fisher Scientific) was done using the ImageQuant LAS 4000 luminescent imager (GE Healthcare Life Sciences) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the membrane was incubated with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific, #34096) and the chemoluminescence signals were detected with the ChemiDoc MP Gel Imaging System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific, 34095).
-
bioRxiv - Cell Biology 2021Quote: ... Chemiluminescence was induced by incubation with SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher, #34096) and recorded with a ChemieDoc MP (BioRad ...
-
bioRxiv - Cell Biology 2021Quote: ... the PVDF membrane was developed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific). The antibodies were removed by the mild stripping buffer (15 g Glycine ...
-
bioRxiv - Systems Biology 2020Quote: ... The membranes were developed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and exposed on a ChemiDoc Touch imaging system (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... the secondary antibody was detected using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific). Bands were visualized using ImageQuant LAS 500 (Cytiva) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Blots were developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (ThermoFisher Scientific, 34095). Protein gels used for protein normalization and blots were imaged using the ChemiDoc™ MP Imaging System (BioRad ...
-
bioRxiv - Cell Biology 2022Quote: ... Signal was detected using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific™), and images captured using a ChemiDoc Imaging System (BioRad®).
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... and developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific™, 34095) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... HRP was detected using SuperSignal™ West Femto Maximum Sensitivity Chemiluminescent Substrate (ThermoFisher Sci.). Digital images were recorded using a ChemiDoc™ Imaging System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The membrane was developed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and analyzed using a ChemiDoc imager (Bio-Rad ...
-
The antibiotic bedaquiline activates host macrophage innate immune resistance to bacterial infectionbioRxiv - Immunology 2019Quote: ... Membranes were washed and exposed to SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher). Detection and quantification of band intensities was performed using Azure Imager C400 (Azure Biosystems ...
-
bioRxiv - Developmental Biology 2020Quote: ... Blots were developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) or ECL™ Prime Western Blotting System (Millipore) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected by chemiluminescence using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific) based on the manufacturer’s specifications and imaged in a ChemiDoc imaging system (Bio-Rad).
-
bioRxiv - Synthetic Biology 2020Quote: ... The immunoblots were developed with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and detected using a ChemiDoc MP system (Bio-Rad Laboratories) ...
-
bioRxiv - Pathology 2021Quote: ... The protein bands were detected using SuperSignal West Femto Maximum Sensitivity substrate (Thermo Scientific).
-
bioRxiv - Genomics 2019Quote: ... Protein bands were visualized using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) and a FUSION SOLO S (VILBER).
-
bioRxiv - Molecular Biology 2021Quote: ... at 1:5000 and SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) were used for protein detection.
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were visualized using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific, 34095) or SuperSignal West Pico PLUS Chemiluminescent Substrate (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... washed with TBST and developed using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific). Analysis of Western blots was performed using Bio-Rad Image Lab Software (version 6.1 ...
-
bioRxiv - Immunology 2022Quote: ... The revelation was performed using the SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific) and images were acquired using an ImageQuant LAS 4000 (GE Healthcare).
-
bioRxiv - Plant Biology 2023Quote: ... bound antibodies were visualized using SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific). Bands were imaged using an image analyzer (ImageQuant LAS 4000 imager ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific) or ECL™ Prime Western Blotting System (Millipore) ...
-
bioRxiv - Microbiology 2022Quote: ... and then developed using SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2024Quote: ... bands were visualized with SuperSignal™ West Femto Maximum Sensitivity Substrate (#34094, Thermo Fisher) and protein band optical intensity was measured using Azure Imaging System and densitometric analysis was performed using Image Studio Lite quantification software ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membranes were developed using SuperSignal West Femto Maximum Sensitivity Substrate (Life Technologies GmbH,34095), Immobilon Western HRP Substrate (Millipore ...
-
bioRxiv - Developmental Biology 2022Quote: ... For western blots after Co-IP SuperSignalTM West Femto Maximum Sensitivity Substrate (Thermo Scientific) was used.
-
bioRxiv - Molecular Biology 2022Quote: ... membranes were treated with SuperSignal™ West Femto Maximum Sensitivity Substrate (Thermo Scientific 34095) before visualization with a Bio-Rad imager ...