Labshake search
Citations for Thermo Fisher :
5001 - 5050 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The pooled samples were fractionated using the Pierce high pH Reversed-Phase Fractionation Kit (Thermo Fisher Scientific 84868) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Complementary DNA was synthesized by the High capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) per manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Complementary DNA was made by use of a high-capacity reverse-transcription kit for liver tissues (Applied Biosystems) and a Vilo reverse-transcription kit for isolated stellate cells (Invitrogen) ...
-
bioRxiv - Genomics 2023Quote: ... cDNA was prepared using the High Capacity cDNA Reverse Transcription Kit (Cat#4368814; Thermo Fisher Scientific, Waltham, MA). Quantitative real-time PCR (RT-PCR ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription was performed using a High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Foster City, CA, USA). Threshold cycle ΔCT methodology was used to calculate the relative quantities of Errfi1 ...
-
bioRxiv - Genomics 2023Quote: ... Total RNA (∼500 ng) was converted to cDNA using the High Capacity RNA to cDNA kit (Thermo Fisher) for RT-qPCR analysis ...
-
bioRxiv - Genomics 2023Quote: ... Each cDNA was generated from 500ng total RNA using the High Capacity RNA-to-cDNA kit (Thermo Fisher). Amplification for ddPCR used the EvaGreen Supermix (BioRad) ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription of isolated RNA was performed using the High-Capacity cDNA RT Kit (Thermo Fisher Scientific, 4368814). Amplification reactions (triplicates ...
-
bioRxiv - Neuroscience 2023Quote: ... 1µg of RNA was amplified into cDNA using Applied Biosystems High Transcription cDNA Synthesis Kit (Thermo Fisher # 4368814). cDNA was amplified using SSO Advanced SyBr Green on the QuantFlex 12K ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and cDNA was synthesized using the High-Capacity cDNA Reverse Transcription kit (4368814, Thermo Fisher, Waltham, MA, USA) according to the supplier protocols ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was generated from 0.5µg of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). For post-mortem brain samples ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from RNA using the Applied Biosystems High-Capacity RNA-to-cDNA Kit (ThermoFisher cat#: 4387406), and qRT-PCR was performed on aStepOnePlus Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed using High-Capacity cDNA reverse Transcription kit (Applied Biosystems, Waltham, MA, USA, cat. 4308228), with 1µg of total RNA according to manufacturer’s guidelines ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... RNA was subsequently converted to cDNA per manufacturer’s instructions (High-Capacity cDNA Reverse Transcription Kit, 4368814, Thermo Fisher). Briefly ...
-
bioRxiv - Physiology 2023Quote: ... cDNA was synthesized using a reverse transcriptase reaction (High-Capacity cDNA Reverse Transcription kit, Applied Biosystems, Waltham, MA). Real-time PCRs were run in duplicate using PerfeCTa SYBR Green FastMix ROX gene expression assay (Quantabio ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was amplified from 1 µg of RNA using a high-capacity cDNA Reverse Transcription Kit (Applied Biosystems). For qPCR ...
-
bioRxiv - Microbiology 2024Quote: ... Purified whole cell RNA was converted to cDNA using the high-capacity cDNA reverse transcription kit (Applied Biosystems). Specific genes were quantified by qRT-PCR with Fast SYBR green master mix (Applied Biosystems ...
-
p110α-dependent hepatocyte signaling is critical for liver gene expression and its rewiring in MASLDbioRxiv - Cell Biology 2024Quote: ... Total RNA samples (2 µg) were reverse-transcribed using the High-capacity cDNA Reverse Transcription Kit (Applied Biosystems) for real-time quantitative polymerase chain reaction (qPCR ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and cDNA was synthesized with 1ug of RNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). SYBR green chemistry was used for quantitative determination of the various mRNAs for Runx-2 ...
-
bioRxiv - Neuroscience 2024Quote: ... Here 300 ng of RNA was reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher) according to the manufacturer’s instructions using a 20 uL reaction volume on a T100 Thermal Cycler (BioRad ...
-
bioRxiv - Neuroscience 2024Quote: ... One microgram of RNA was converted into cDNA using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). qPCR was performed using PowerUp Sybr Green reagents (Applied Biosystems ...
-
bioRxiv - Physiology 2024Quote: ... and 200ng of RNA was reverse-transcripted using a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814) in 20µL.
-
bioRxiv - Microbiology 2023Quote: ... and the RNA was converted into cDNA using the High-Capacity cDNA Reverse Transcription kit (Applied Biosystems™). qRT-PCR was performed in a final volume of 10 μL using Maxima™ SYBR Green qPCR Master Mix (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... Reverse transcription of 2 µg RNA was completed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA samples were th converted to cDNA using high-Capacity RNA-to-cDNA kit (Applied Biosystems, cat#:4387400). qPCR reaction was performed in a 10 uL volume using the qPCR primers listed in Table 2 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Four µg of cDNA per sample was synthesized using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNA was prepared from total RNA using the High Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, UK) (24) ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was then converted into cDNA using the High-Capacity RNA-to-cDNA kit (Applied Biosystems, Cat# 4388950), following the manufacturer’s instruction.
-
bioRxiv - Cell Biology 2023Quote: ... total RNA was retrotranscribed with the High Capacity cDNA Reverse Transcription Kit with RNase Inhibitor (Thermo fisher, 4368814). cDNA was preamplified with Taqman PreAmp Master Mix containing a Taqman Assay-based pre-amplification pool composed of a mix of the Taqman assays indicated in Supplementary Table 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of RNA was subjected to reverse transcription reaction with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). 1 μL of cDNA was subjected to PCR with exon-specific primers using Platinum Taq DNA Polymerase (ThermoFisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of RNA was subjected to reverse transcription reaction with High-Capacity cDNA Reverse Transcription Kit (ThermoFisher). Quantitative RT-PCR reactions were measured on a Viia 7 Real-Time PCR system (ThermoFisher ...
-
bioRxiv - Biochemistry 2023Quote: ... following the manufacturer’s instruction and cDNA was synthesized with a High-Capacity Reverse Transcription kit (Applied Biosystems #4368814). cDNA was diluted to 10 ng/µL and 20 ng was used for qPCR reactions ...
-
bioRxiv - Physiology 2023Quote: ... Total RNA (0.5µg) was converted into cDNA using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368814). RT-qPCR was performed using the Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... Reverse transcription was performed by using High Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific K.K., Tokyo, Japan). Quantitative real-time PCR was performed on a StepOnePlus Real-Time PCR system with TaqMan Fast Universal PCR Master Mix (Thermo Fisher Scientific K.K. ...
-
bioRxiv - Physiology 2024Quote: ... Reverse-transcription was performed with 850 ng of RNA using the High Capacity cDNA RT kit (Applied Biosystems). Gene expression analysis was carried out using the Wafergen Smartchip cycler and Smartchip Multisample Nanodispenser (Biogenouest Genomics and the EcogenO core facility ...
-
bioRxiv - Immunology 2024Quote: ... and complementary DNA (cDNA) synthesis was performed using the High-Capacity cDNA reverse transcription kit (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA from tissue samples was reverse transcribed using High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, 4368813) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... and conversion of RNA to cDNA was performed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). For gene expression analysis we performed RT-qPCR using TaqMan™ Universal Master Mix II ...
-
bioRxiv - Plant Biology 2024Quote: ... For cDNA synthesis 1 µg RNA was used with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Relative expression of target genes was quantified by RT-qPCR (95 °C 3 min ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized from purified RNA using the High Capacity cDNA Reverse Transcription kit (Cat# 4368814) from ThermoFisher. Real time quantitative PCR was performed with primers GCTGAGTCCGCAGCAGG and CAGGGTCCAACTTGTCCAGAAT (spliced XBP1) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... cDNA was synthesized from the purified RNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific).
-
bioRxiv - Evolutionary Biology 2024Quote: ... cDNA was synthesized from the extracted RNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific). Dsx ...
-
bioRxiv - Immunology 2024Quote: ... RNA was reverse-transcribed to cDNA using high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA). Then we used Taqman Master Mix (Applied Biosystems ...
-
Aberrant regulation of serine metabolism drives extracellular vesicle release and cancer progressionbioRxiv - Cancer Biology 2024Quote: ... complementary DNA was generated from total RNA using a High Capacity cDNA Reverse Transcription Kit (4368814, Applied Biosystems). Total RNA was reverse transcribed using a TaqMan miRNA Reverse Transcription Kit from Applied Biosystems for the measurement of miR-891b expression (4366597 ...
-
bioRxiv - Cell Biology 2024Quote: ... We next converted 2 ug of RNA to cDNA using a high-capacity RNA to cDNA kit (Thermofisher) and performed qPCR using GoTaq qPCR reagent ...
-
bioRxiv - Bioengineering 2024Quote: ... Reverse transcription was performed according to manufacturer’s protocols via a High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative PCR was performed using PrimeTime qPCR Primers (Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg of total RNA was reverse transcribed into cDNA using High Capacity cDNA transcription kit (ThermoFisher Scientific). Expression of marker genes was compared to expression of the two housekeeping genes GAPDH and ACTB ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription PCR was performed using the High-Capacity cDNA Reverse Transcription Kit (Fisher Scientific, 43-688-14). Quantitative PCR is performed on the QuantStudio 3 using SYBR Green (Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Reverse transcription was conducted with random hexamer primers using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems). The RT procedure included primer extension at 25°C for 10 minutes ...
-
bioRxiv - Biochemistry 2024Quote: ... RNA samples were immediately used for cDNA synthesis employing a high-capacity RNA-to-cDNA kit (Applied Biosystems) with random hexamer primers ...