Labshake search
Citations for Thermo Fisher :
5001 - 5050 of 10000+ citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... 5% CO2 and passaged twice a week using Trypsin-EDTA (0.25%) (Life Technologies). Cells were tested for mycoplasma contamination using the MycoAlert Mycoplasma Detection Kit (Lonza) ...
-
bioRxiv - Neuroscience 2021Quote: ... The precipitants were washed 5-times using DynaMag-2 (Thermo Fisher Scientific, 12321D) and subjected to reverse transcription for quantitative real time PCR to quantify relative levels of CSDE1-associated Gpr151 ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were stained for DAPI (Thermo Fisher R37606, 5 min at room temperature) before mounting coverslips on slides in Fluoromount (Sigma F4680 ...
-
bioRxiv - Neuroscience 2021Quote: ... either filled with 5 µl of 10% Fluoro-Ruby (Invitrogen, Carlsbad, CA, USA) or 5 µl of 2% Fast-Blue (Polysciences ...
-
bioRxiv - Immunology 2020Quote: ... first with 2 mM disuccinimidyl glutarate (ThermoFisher Scientific, 20593, CAS: 79642-50-5) for 30 minutes at RT ...
-
bioRxiv - Biochemistry 2021Quote: ... and 5-aminolevulinic acid hydrochloride were purchased from Acros Organics (Fair Lawn, NJ). The 11-hydroxylauric and 12-hydroxylauric-d20 acid standards were purchased from Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2021Quote: ... incubated in medium containing 20 mM EdU (5-ethynyl-2-deoxyuridine, Life Technologies) for the final 30 min and then washed with PBS and fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Biochemistry 2020Quote: ... The flow cell was incubated with 5 μg/ml of Neutravidin (Molecular probes) in RB for 2 min ...
-
bioRxiv - Microbiology 2021Quote: ... livers were mechanically disrupted in 5 mL DMEM medium (Thermo Fisher scientific, USA) containing liver dissociation enzymes ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were maintained at 37 °C in 5% CO2 in Neurobasal Medium (Gibco) supplemented with 1x B27 and 1x Glutamax ...
-
bioRxiv - Cancer Biology 2021Quote: ... The samples were resolved on a 5-15% Bis-Tris gel (Thermo Fisher) followed by blotting ...
-
bioRxiv - Microbiology 2021Quote: ... (5) washed extensively and incubated with highly cross-absorbed anti-rabbit Alexa568 (ThermoFisher), anti-chicken IgY FITC (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative RT-PCR was performed using Quantstudio 5 (Thermo Fisher Scientific, Berlin, Germany) and GoTag®qPCR Master Mix with SYBR green fluorescence (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: NK cells were treated with 5 μM CellTrace CFSE (Invitrogen, cat no. C34554A) in RMPI media+ 5% FBS for 5 minutes ...
-
Cardiac fibroblasts regulate cardiomyocyte hypertrophy through dynamic regulation of type I collagenbioRxiv - Cell Biology 2022Quote: ... Wheat germ agglutinin (488) was from ThermoFisher (W11261; 5 µg/ml for IF).
-
bioRxiv - Biochemistry 2022Quote: ... a 1 ml click reaction containing 5 μl 1 mM Azide-488 (Invitrogen), 100 μl 20 mg/ml sodium ascorbate ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.125 IU/mL Insulin (Novo Nordisk) and 5 ng/mL mEGF (Life Technologies). The human mammary epithelial cell line PMC42 was a gift from Professor Leigh Ackland (Deakin University ...
-
bioRxiv - Immunology 2020Quote: ... 5×105 of human or mouse blood cells were incubated in αMEM (Gibco) including 10% (v/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... QuantStudio 5 or QuantStudio 12K Flex Real-Time PCR Systems (Thermo Fisher Scientific). qPCR primers were designed using NCBI tool Primer BLAST and are listed in Table S4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 5 μL of 2x Power SYBR Green PCR Master Mix (Thermo Fisher), and the reaction run for 30 cycles in a CFX Connect™ Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Immunology 2020Quote: ... wheat germ agglutinin (WGA) Alexa Fluor 647 conjugate (Invitrogen, W32466, 5 μg/mL), WGA CF405S conjugate (Biotium ...
-
bioRxiv - Cell Biology 2020Quote: ... the wells were incubated for 5 min with Tetraspeck Beads (Thermofisher, 1:100) and subsequently washed with PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 U/ml of penicillin-streptomycin antibiotics (Gibco, Grand Island, NY, USA). Transfection of in vitro-synthesized RNAs into S2 cells was performed using TransMessenger reagent (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression was measured by qPCR on a QuantStudio 5 (Thermo Fisher Scientific) and normalized in qbase+ 3.0 (Biogazelle ...
-
bioRxiv - Biophysics 2020Quote: ... Cell nuclei were stained with Hoechst dye (5 μg/ml, Thermo Fisher Scientifc) diluted in external microscopy buffer ...
-
bioRxiv - Immunology 2020Quote: ... Cells were grown for 5–6 days in IMDM (Thermo Fisher Scientific, 12440053) supplemented with 1% non-essential amino acids (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2020Quote: ... 5 µL of Oligo-(dT)25 beads (Dynabeads, Thermo Fisher Scientific, Waltham MA) were added and incubated with gentle shaking for 15 min at 25°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 U/µl Taq Polymerase (Invitrogen Platinum®Taq Polymerase, Qty. 300 Rxn) and 2.5 µl DNA template ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 5% fetal bovine serum (Gibco, Waltham, MA, USA; Cat# 26140-079), and 1% penicillin-streptomycin (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained for 5 min with 1 μg/ml Hoechst 33342 (Invitrogen) in PBS at room temperature and cells were mounted in Mowiol 4-88 (Calbiochem ...
-
bioRxiv - Physiology 2021Quote: ... using 5 µM of either Silencer® Select (Thermo Fisher Scientific, Waltham, MA) Negative Control No ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 5 μL of a 5x 250 nM LysoTracker Deep Red (Invitrogen, Carlsbad, CA) diluted in Live Cell Imaging Buffer (Invitrogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... claudin-5 (1:100) and occludin (1:50) (all from Thermo Fisher Scientific) at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μL of 2x Power SYBR™ Green PCR Master Mix (ThermoFisher Scientific), 1 μL each of forward and reverse primers ...
-
bioRxiv - Microbiology 2021Quote: ... Medium was supplemented with chloramphenicol (CAM, 12. 5 μg mL−1, ThermoFisher Scientific) and/or kanamycin (KAN ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen Life Technologies, VIC, Australia), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 5% CO2 in Dulbecco’s Modified Eagle’s Medium (DMEM, Invitrogen Life Technologies, VIC, Australia), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2020Quote: ... ED cells were cultured at 37°C and 5% CO2 in DMEM (Gibco) supplemented with 1 mM of sodium pyruvate (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1% (v/v) Triton X100 and 5 U/ml Turbo DNase (Invitrogen, Cat:AM2238) (Ingolia et al. ...
-
bioRxiv - Immunology 2021Quote: ... cells were selected by addition of media containing 5 μg/ml puromycin (Gibco). Surviving cells were used for experiments.
-
bioRxiv - Biochemistry 2020Quote: ... the 5-HT2CR-BRIL construct was subcloned into a modified pFastBac1 vector (Invitrogen). The construct was optimized with the truncation of N-terminal residues (1-39 ...
-
bioRxiv - Bioengineering 2020Quote: ... 2.5 μM of CellTracker™ Green 5-chloromethylfluorescein diacetate CMFDA (Molecular Probes, #C7025) was used to label WT-PGP1 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were passaged no more than 5 times using Trypsin-EDTA (Life Technologies) and maintained in 10% FBS in DMEM.
-
bioRxiv - Genomics 2021Quote: ... pelleted at 6,000 xg for 5 min and incubated with digestion buffer (ThermoFisher Scientific ER0932 plus 0.2% NP-40 ...
-
bioRxiv - Microbiology 2021Quote: ... for 5 mins before mounting coverslips with ProLong Gold Anti-Fade reagent (Invitrogen). Images were collected using Olympus FLUOVIEW FV3000 and were processed using Photoshop (Adobe ...
-
bioRxiv - Physiology 2020Quote: ... 5 μL of Power SYBR Green master mix (Thermo Fisher Scientific, Waltham, MA) and 2 μL of RNA/DNA free water ...
-
bioRxiv - Neuroscience 2021Quote: ... 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, ThermoFisher Scientific, Waltham, MA, USA) supplemented with fetal bovine serum (FBS ...