Labshake search
Citations for Cell Signaling Technology :
151 - 200 of 296 citations for Rat Colony Assay Media since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... The gel supershift assay was performed by adding p-65 antibody (Cell Signaling) prior to the addition of the fluorescently labeled probe ...
-
bioRxiv - Neuroscience 2023Quote: ... TUNEL staining was performed using the 594-TUNEL Assay Kit (Cell Signaling #48513) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... The ChIP assay was performed using control IgG (Cell Signaling Technology, Cat. 3900) or anti-YAP1 antibody (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2020Quote: ... The membranes were then washed in 1X TBS with 0.05% Tween 20 and incubated with HRP-linked anti-rat secondary antibody (1:3000, Cell Signaling Technology®, 7077S) or anti-mouse secondary antibody (1:3000 ...
-
bioRxiv - Neuroscience 2022Quote: ... three times and incubated with horseradish peroxidase-conjugated secondary antibodies (Mouse, Cell Signaling, cat #7076S; Rabbit, Cell Signaling, cat #7074S; Rat, Cell Signaling, cat #7077S ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were incubated overnight with one of the following rabbit primary antibodies (all from Cell Signaling Technology and all cross-react with rat): anti-Pan-AKT (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Anti-rat secondary antibody was used for detection of primary antibodies and visualized by SignalStain DAB Substrate kit (Cell Signaling Technology, Danvers, MA). All stained tissues were blindly evaluated by pathologists ...
-
bioRxiv - Neuroscience 2023Quote: ... blots were washed in 1x TBST and incubated with appropriate HRP-conjugated secondary (Goat anti-rat 7077, Cell Signaling, Goat anti-mouse 7076, Cell Signaling, Goat anti-rabbit 7074, Cell Signaling) for two hours with 2% milk powder in TBST ...
-
bioRxiv - Cancer Biology 2022Quote: CUT&RUN was performed using a CUT&RUN Assay Kit (Cell Signaling Technology, 86652) with a modification of the manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ChIP assay was performed using the SimpleChIP Enzymatic Chromatin IP Kit (Cell Signaling Technology) as previously described50 ...
-
bioRxiv - Neuroscience 2022Quote: ... or both and lysed in radioimmunoprecipitation assay (RIPA) buffer (Cell Signaling Technology, Danvers, MA) supplemented with protease and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... Assay results were analyzed by western blot with Anti-ERK (Cell signaling technology, #9102) and pERK(Cell signaling technology ...
-
bioRxiv - Biochemistry 2023Quote: ... cGMP was measured using Cyclic GMP XP® Assay Kit from Cell Signaling (#4360).
-
bioRxiv - Microbiology 2023Quote: ... XTT assay was performed with the XTT Cell Viability Kit from Cell Signaling Technology. At the harvest time point ...
-
bioRxiv - Developmental Biology 2023Quote: CUT&RUN was performed using the CUT&RUN Assay Kit (Cell signaling Technology #86652) and according to the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... a senescence-associated β-galactosidase (SA-β-gal) assay (Cell Signaling Technology, Kit #9860) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The senescence assay was conducted using Senescence β-Galactosidase Staining Kit (Cell Signaling, 9860). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... The reaction was stopped by directly replacing the culture media with 100 µL ice-cold RIPA buffer (Cell Signaling, 9806S) supplemented with cOmplete protease inhibitor (1× ...
-
bioRxiv - Cell Biology 2021Quote: ... the membrane was incubated with HRP-conjugated anti-rabbit IgG or HRP-conjugated anti-rat IgG secondary antibody (Cell Signaling Technology, Danvers, MA, USA) for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... The following siRNAs were used for functional assays: siRNA FYN#1 (Cell Signaling Technology #12473), siRNA FYN#2 5’GGCCCTTTATGACTATGAATT3’ ...
-
bioRxiv - Neuroscience 2020Quote: ChIP assays were performed using a SimpleChIP Enzymatic Chromatin IP kit (#9003; Cell Signaling Technologies). Briefly ...
-
bioRxiv - Pathology 2022Quote: ... and pull-down assays include monoclonal rabbit α-Notch1 (3608S; Cell Signaling Technology, Danvers MA), polyclonal rabbit α-Notch1 ...
-
bioRxiv - Immunology 2021Quote: ... Akt kinase activity was measured using an Akt Kinase Activity Assay Kit (Cell Signaling Technology). Rheb-GTP levels were assessed using a Rheb Activation Assay Kit (New East Biosciences) ...
-
bioRxiv - Cell Biology 2022Quote: SA-β-Gal enzymatic activity assay was performed following the manufacturer’s instructions (Cell Signaling Technology). Briefly ...
-
bioRxiv - Physiology 2022Quote: ... Cyclic AMP in the supernatants were measured using cAMP assay kit (4339, Cell Signaling Technology) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2023Quote: CUT&RUN was performed using the CUT&RUN Assay Kit (Cell Signaling Technology, Cat. #86652) using the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... The generated cGMP was then estimated by the cGMP ELISA assay kit (Cell Signaling Technology).
-
bioRxiv - Cancer Biology 2023Quote: ChIP assays were performed using the SimpleChIP Enzymatic Chromatin IP Kit (9003S; Cell Signaling Technology) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: EOC cell lines were lysed in 1x radioimmunoprecipitation assay buffer (RIPA, Cell Signaling Technology, BioConcept) containing a proteinase inhibitor cocktail (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2020Quote: ... mouse anti-MSP1 antibody (European Malaria Reagent Repository, 1:500), rat anti-PfBiP MRA-1247 (BEI Resources, NIAID, NIH, 1:100) and mouse anti-HA(6E2) (Cell Signaling Technology Inc., 1:100). Anti-mouse and anti-rat antibody conjugated to Alexa Fluor 488 or Alexa Fluor 546 (1:100 ...
-
bioRxiv - Cell Biology 2019Quote: ... 100,000 cells were plated in each well the same day of the assay and allowed to attach for 5 hours in growth media in the presence of 5μM ROCK inhibitor (13624, Cell Signaling Technology). Subsequently growth media was replaced with Seahorse base media (102353-100 ...
-
bioRxiv - Neuroscience 2020Quote: ... slices were incubated overnight at 4 °C with the respective primary antibodies (rat-monoclonal anti- BrdU −1:200- Abcam; Rabbit polyclonal antibody anti-DCX,1:500- Cell Signaling; mouse monoclonal anti-NeuN- Millipore) diluted in a 0.1 % BSA and 0.125 % Triton X-100 solution ...
-
bioRxiv - Developmental Biology 2023Quote: ... diluted 1:100), Rat anti-GFP monoclonal antibody (nacalai tesque, GF090R, diluted 1:1000) and rabbit anti-pSmad1/5/9 antibody (Cell Signaling Technology, #13820, diluted 1:100). After the primary antibody incubation ...
-
bioRxiv - Physiology 2022Quote: ... Slides are them washed with PBS and a coverslip is placed over the slides using Prolong Gold’s Anti-fade mounting media (Cell Signaling technologies 9071S). Finished slides are stored at 4 degrees and imaged at 10X within 2 weeks ...
-
bioRxiv - Cell Biology 2021Quote: A BrdU cell proliferation assay was conducted according to the supplier’s instructions (Cell signaling, Danvers, MA). Briefly ...
-
bioRxiv - Cancer Biology 2019Quote: A ChIP assay was performed using the SimpleChIP enzymatic chromatin immunoprecipitation kit (Cell Signaling Technology, #9002) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: A ChIP assay was performed using the SimpleChIP Enzymatic Chromatin IP kit (9003; Cell Signaling Technology). Chromatin prepared from 2 × 106 cells (in a 10-cm dish ...
-
bioRxiv - Developmental Biology 2022Quote: ... The single-cell suspension was processed using a Cut and Run assay kit (86652, Cell Signaling) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the β-galactosidase assay was performed using the Senescence beta-Galactosidase Staining Kit (Cell Signaling, 9860S) according to the supplied protocol.
-
bioRxiv - Genetics 2021Quote: This assay was performed using the SimpleChIP® Plus Enzymatic Chromatin IP Kit (Cell Signaling Technology). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: CUT & RUN was performed using Cell Signaling Technology CUT & RUN Assay kit (Cell Signaling Technology #86652) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... SA-β-gal assay was performed using the senescence β-galactosidase staining kit (Cell Signaling #9860). At least ten randomly selected fields from the 20X magnification of the bright-field microscope (∼500 cells ...
-
bioRxiv - Cancer Biology 2023Quote: Preparation of CUT&RUN libraries was done with the CUT&RUN assay kit (Cell Signaling Technology). Briefly ...
-
bioRxiv - Genetics 2022Quote: ... with modifications for CUT&RUN as noted in the CUT&RUN Assay Kit (Cell Signaling, #86652S). All libraries were quantified on the Qubit 4.0 and library quality assessed using Agilent High Sensitivity DNA Tapestation (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... and isotype control IgG (CST, 2729) and the CUT&RUN Assay Kit (Cell Signaling Technology, 86652). The resulting DNA fragment samples were generated into libraries using the SimpleChIP® ChIP-seq DNA Library Prep Kit for Illumina® (Cell Signaling Technology ...
-
bioRxiv - Genomics 2023Quote: ... The senescent state of the cells was addressed by senescence-associated β-galactosidase assay (Cell Signaling) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... At 4 hpi media was removed from the well by pipetting and the neutrophils were lysed in 30uL of 1X RIPA buffer (Cell Signaling Technology, 9806) containing cOmplete EDTA-free protease inhibitor cocktail (Sigma ...
-
bioRxiv - Physiology 2020Quote: ... ChIP assays were performed using the SimpleChIP® Plus Enzymatic Chromatin IP Kit (Magnetic Beads; Cell Signaling). Chromatin lysates were prepared ...
-
bioRxiv - Cancer Biology 2021Quote: The chromatin immunoprecipitation (ChIP) assay was performed with the Simplechip Enzymatic Chromatin IP kit (Cell Signaling Technology). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The senescence assay was performed using the senescence β-Galactosidase staining kit from Cell Signaling Technology (#9860) following manufacturer instructions ...