Labshake search
Citations for Beckman :
401 - 450 of 1491 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM Tris pH 7.4) and transferred to a thick-wall polypropylene centrifuge tube (Beckman-Coulter, #349623). Tubes were ultracentrifuged at 50k rpm at 4C in a SW 55 Ti rotor in a Beckman Optima XL-80K Ultracentrifuge ...
-
bioRxiv - Microbiology 2022Quote: ... 10 ml of SIP was loaded into thin wall polypropylene centrifuge tubes (14 × 89 mm) (Beckman Coulter) along with 1 ml of bacterial sample and 50 μl of buoyancy centrifuge beads ...
-
bioRxiv - Immunology 2022Quote: Sucrose gradients (15-60%) were prepared in SW55Ti rotor-compatible Ultra-Clear ultracentrifuge tubes (Beckman Coulter, 344057). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 0.25 M sucrose and 40% Optiprep (OP) and placed in ultra-clear centrifuge tubes (Beckman, 344059). Discontinuous OP gradients were prepared by layering 2 mL of 60 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Centrifugations at 10,000 g (k-factor = 2547.2) and 100,000 g (k-factor = 254.7) were done at +4°C using polyallomer tubes (Beckman Coulter Inc. ...
-
bioRxiv - Physiology 2023Quote: ... Each blood sample was immediately placed into a heparin/lithium-coated tube (Beckman Coulter #652825, Indianapolis, IN) placed on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... the C-tubes were quickly spun in a chilled (4°C) Allegra-30R centrifuge (#B08708, Beckman Coulter) with an SX4400 swinging bucket rotor to collect the samples in the bottom of the tubes ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 mM EGTA and 30% Percoll (v/v)) in 14 × 89-mm centrifuge tubes (cat. 344059, Beckman). The tubes were then centrifuged on a SW 41 Ti rotor (Beckman ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 10,000 g for 30 min (JXN-30 with JS-24.38 rotor and tube 364772, Beckman Coulter), and at 100,000 g for 110 min (JXN-30 with JS-24.38 ...
-
bioRxiv - Cell Biology 2023Quote: ... and carefully layered on top of 3ml of sucrose buffer in a centrifuge tube (344060, Beckman Coulter). The tube was filled with wash buffer to create a sucrose gradient ...
-
bioRxiv - Genomics 2023Quote: ... the C-tubes were quickly spun in a chilled (4°C) Allegra-30R centrifuge (#B08708, Beckman Coulter) with an SX4400 swinging bucket rotor to collect the samples in the bottom of the tubes ...
-
bioRxiv - Microbiology 2023Quote: ... 50 µg/ml CHX) prepared using a BioComp gradient master in ultra-clear centrifuge tubes (Beckman Coulter) and centrifuged for 2:30 hours at 36.000 rpm in an SW41 rotor ...
-
bioRxiv - Cell Biology 2023Quote: ... The liposome solutions were transferred to 5 × 41 mm ultracentrifuge tubes (Beckman Coulter, CA, USA; Cat. #344090). Two millimolar liposomes were mixed with the indicated concentration of proteins to a total volume of 150 µL ...
-
bioRxiv - Neuroscience 2024Quote: ... This was carefully layered on top of 2ml 35% iodixanol in a clear polycarbonate tube (Beckman 355672) and centrifuged at 10,000x g for 30 min at 4C with deceleration turned off ...
-
bioRxiv - Cell Biology 2024Quote: ... The tubes were then centrifuged at 200,000 g for 1 h at 22 °C (TL 100, Beckman). After ultracentrifugation ...
-
bioRxiv - Microbiology 2019Quote: ... PCR clean-up: 25 µL PCR product was mixed with AMPure XP beads (Beckman Coulter Genomic, USA), and incubated for 5 min ...
-
bioRxiv - Systems Biology 2020Quote: ... PCR products were size selected and cleaned up using AMPure XP PCR Purification solution (Beckman Coulter™). After purification ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we purified the product of the second PCR reaction with Agencourt AMPure XP PCR purification kit (Beckman Coulter). We performed sequencing on MiSeq or NextSeq platforms (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... The amplified PCR product was purified and size selected using the AMPure XP PCR Cleanup system (Beckman Coulter). Barcoded products were pooled in equimolar concentrations and send for paired-end Illumina sequencing (2×250 bp HiSeq2500 ...
-
bioRxiv - Biophysics 2021Quote: ... The centrifuge tubes containing the sample and gradient were loaded into a swinging bucket rotor (Beckman TLS 55). The samples were centrifuged at 50,000 rpm (~150,000 g ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 mM Tris-HCl in DEPC-treated water) in a thick-walled ultracentrifuge tube (Beckman Coulter, Cat # 355631) and spun at 107,000 RCF ...
-
bioRxiv - Biophysics 2019Quote: ... transferred to 50 ml polypropylene tubes and centrifuged for 10 minutes at 22°C at 3000 xg (Beckman Coulter Allegra X-12R ...
-
bioRxiv - Neuroscience 2019Quote: ... homogenized and then added onto a sucrose cushion (2ml) in a 10ml Ultra-Clear centrifuge tube (Beckman Coulter). The nuclei were then separated from the tissue by centrifugation (26.500xg at 4°C for 1.5 hours) ...
-
bioRxiv - Biophysics 2021Quote: ... at 16,000 rpm (low-speed) in a TLA-100 rotor and polycarbonate centrifugation tubes (Beckman Coulter No.343775). This pellet was the ‘low-speed’ pellet ...
-
bioRxiv - Neuroscience 2020Quote: ... Iodixanol gradients were layered in 13.2 mL thin wall tubes (14 × 89 mm, Beckman Coulter, Indianapolis, IN, USA). The Iodixanol steps were layered in the following order ...
-
bioRxiv - Microbiology 2022Quote: ... solution was added 1:1 to EV suspensions and transferred to an MLS-50 rotor tube (Beckman; 344057). Iodixanol stock was then diluted in 0.25 M sucrose-Tris buffer to make 10% and 20% iodixanol solutions ...
-
bioRxiv - Cell Biology 2022Quote: ... 12 ml samples were added to 14 × 89 mm ultra-clear centrifuge tubes (Beckman Coulter, Inc., Brea, CA) and centrifuged at 10,000g and 4°C for 30 minutes (SW41 rotor ...
-
bioRxiv - Plant Biology 2022Quote: ... Samples were further pooled into a single tube and 30 µL Ampure XP beads (Beckman Coulter Life Sciences) with 66 µL bead binding buffer (2.5 M NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were collected in 50 mL Falcon® tubes and centrifuged at 7000 rpm (JA12 rotor, Beckman) for 10 min at 20 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 50 μL of 1X SN buffer on top) in a thin-walled ultracentrifuge tube (Beckman Coulter; 355090), and centrifuging them at 48,000 rpm for 4 hrs at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... products of one plate were pooled into one tube and cleaned up using AMPure XP beads (Beckman Coulter). After in vitro transcription and fragmentation ...
-
bioRxiv - Physiology 2021Quote: The CM was thawed on ice and transferred into 13.5 mL Ultra-Clear ultracentrifuge tubes (Beckman Coulter, USA). Samples were spun at 120k xg for 2 hours or 200k xg for 70 min at 4°C in a Beckman Coulter Ultracentrifuge Optima XE-90 ...
-
bioRxiv - Genetics 2021Quote: ... Reactions were then pooled in a 5 ml tube and purified using a 0.7x SPRIselect (Beckman Coulter B23318) cleanup and eluted in 450μL of TE ...
-
bioRxiv - Neuroscience 2021Quote: ... The viral suspension was loaded on the iodixanol gradient in Quick-seal polyallomer tubes (Beckman-Coulter, Cat# 342414) and spun in a VTi-50 rotor at 50,000 rpm for 75 mins at 12 °C in an Optima L-100 XP Beckman Coulter ultracentrifuge ...
-
bioRxiv - Microbiology 2022Quote: ... The sample-containing tube was spun at 31,000 RPM for 18 hours using SW 32.1 rotor (Beckman Coulter). 1-mL fractions were collected from the bottom of the tube ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 20 mM dithiothreitol [DTT] at pH 8.0) in an ultracentrifuge tube (13.2 mL Beckman Coulter SW-41). Gradients were centrifuged in a SW40-Ti rotor at 35,000 rpm for 2 h and 30 min at 4 °C in a Beckman Coulter Optima XPN-80 ultracentrifuge ...
-
bioRxiv - Microbiology 2022Quote: ... and 1.7) and phage solution were overlaid in tubes and ultracentrifuged (Optima MAX-TL; Beckman Coulter, California, USA) at 100,000 ×g for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μg of genomic DNA was loaded into 5.6-ml polyallomer quick-seal centrifuge tubes (Beckman Coulter, USA) containing gradient buffer [20] and CsCl ...
-
bioRxiv - Systems Biology 2023Quote: ... Tubes were spun at 31,000 rpm for 3h at 10°C in an SW41 rotor (Beckman Coulter ultracentrifuge) and the resulting phage band had a buoyant density of 1.36 g/ml ...
-
bioRxiv - Cell Biology 2023Quote: ... 40ml of fresh pTRIP-SFFV-GFP-NLS lentivector supernatant were loaded in Ultra-Clear Centrifuge tubes (Beckman Coulter) and ultracentrifuged at 100,000g in a SW32 rotor (Beckman coulter ...
-
bioRxiv - Immunology 2022Quote: ... The homogenized tissue was transferred into open-top thick-walled polycarbonate ultracentrifuge tubes (25×89 mm, Beckman Coulter) on ice ...
-
bioRxiv - Biophysics 2023Quote: ... transferred to 50 ml polypropylene tubes and centrifuged for 10 minutes at 22°C at 3000 xg (Beckman Coulter Allegra X-12R ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 7.8) in 14×89 mm thin wall polypropylene centrifuge tubes (cat#: 344059, Beckman Coulter, Brea, CA, USA). An Optima L-80 Ultracentrifuge (serial# ...
-
bioRxiv - Neuroscience 2024Quote: ... The homogenate was filtered with a 70 µm strainer and transferred into an ultracentrifuge tube (Beckman Coulter, 331372). Sucrose solution (1.8 M sucrose ...
-
bioRxiv - Cell Biology 2024Quote: ... Linear sucrose gradients of 10–50% were prepared in SW41 centrifugation tubes (Beckman Coulter, Ultra-Clear™ 344059), using the Gradient Station (BioComp) ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR reaction was purified and size selected using Agencourt AMPure XP-PCR magnetic beads (Beckman Coulter, Pasadena, CA). Each sample was quantified using the Qubit fluorometeric system (Thermo-Fisher ...
-
bioRxiv - Genomics 2021Quote: ... PCR was then performed using the SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT) and then cDNA purified using AMPure beads (Beckman Coulter). In order to achieve a high concentration of cDNA the input was subjected to 25 cycles of PCR amplification ...
-
bioRxiv - Cell Biology 2020Quote: ... and 25% Histodenz™ in SHE buffer was layered in 14 Å∼ 89 mm Ultra-Clear centrifuge tubes (Beckman) and the tubes were sat at 4°C for 3–4 h to allow the Histodenz™ to diffuse ...
-
bioRxiv - Cell Biology 2019Quote: ... A 0.6-1.9 M continuous sucrose gradient was prepared in 10 mM HEPES pH 7.2 in ultracentrifuge tubes (Beckman Coulter) that were coated with Sigmacote (Sigma #SL2) ...
-
bioRxiv - Cell Biology 2020Quote: ... Unbound protein was separated from liposomes by transferring 100μl of this mixture to 7×20mm PC ultracentrifuge tubes (Beckman) and carefully layering an equal volume of 0.75M sucrose buffer followed by 25μl of sucrose-free HK buffer ...