Labshake search
Citations for Beckman :
101 - 150 of 515 citations for RPA kit reagent since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... and purification via Agencourt AMPure XP Reagent (Beckman Coulter, CA). Library quantification was performed with an Agilent DNA 1000 Kit (Agilent ...
-
bioRxiv - Molecular Biology 2022Quote: ... The amplified product was purified with SPRIselect reagent (Beckman-Coulter) using 0.4× and 1.2× two-sided purification according to the Chromium Next GEM Single Cell ATAC Reagent Kits v1.1 (Step 4.2) ...
-
bioRxiv - Bioengineering 2020Quote: ... Post ligation cleaned up using the SPRIselect Reagent (Beckman Coulter). Sample indexing was done using the i7 Sample Index Plate (Chromium ...
-
bioRxiv - Genomics 2020Quote: ... An equal amount of 1x SPRIselect reagent (Beckman Coulter B23317) was added followed by rotation for 20 min ...
-
bioRxiv - Genomics 2021Quote: ... The resulting products were purified using SPRIselect Reagent (Beckman Coulter) in 1X to 1.8X reactions and used as templates for a second PCR to add indexes to the amplified fragments ...
-
bioRxiv - Systems Biology 2023Quote: ... Libraries were purified using SPRI Select Reagent (Beckman Coulter #B23317) and eluted in 20µL water.
-
bioRxiv - Microbiology 2023Quote: ... amplicons were purified using the AMPure XP reagent (Beckman Coulter) and the appertaining protocol for PCR cleanup ...
-
bioRxiv - Microbiology 2023Quote: ... amplification was done with SPRIselect Reagent (Beckman Coulter, CA, USA). Samples were pooled and sequenced for 150 bp read length in paired-end mode ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR-samples were purified with the SPRIselect reagent (Beckman Coulter) with double-sided size selection ...
-
bioRxiv - Microbiology 2019Quote: ... The library was purified using Agencourt AMPure XP Reagent beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Bioengineering 2020Quote: ... Amplified cDNA was cleaned up using the SPRIselect Reagent (Beckman Coulter). Post cDNA amplification QC and quantification was done using a High Sensitivity D5000 ScreenTape Assay (Agilent ...
-
bioRxiv - Neuroscience 2019Quote: ... cDNA libraries were then cleaned with SPRISelect Reagent (Beckman Coulter #B23318) and eluted in 23 μL of 0.1X TE buffer ...
-
bioRxiv - Immunology 2019Quote: ... cells were fixed and permeabilized with IntraPrep Permeabilization Reagent (Beckman Coulter) according to the manufacturer’s protocols ...
-
bioRxiv - Genomics 2021Quote: ... Amplified DNA was purified for sequencing using SPRIselect Reagent (Beckman Coulter) in a 0.8X reaction ...
-
bioRxiv - Genomics 2021Quote: ... Amplified DNA was purified for sequencing using SPRIselect Reagent (Beckman Coulter) in 1X to 1.8X reactions ...
-
bioRxiv - Cancer Biology 2022Quote: ... the libraries were purified with the AMPure XP Reagent (Beckman Coulter) and quantified using the KAPA Library Quantification Kit (KAPA Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... then subjected to Dynabeads (2000048) and SPRIselect reagent (Beckman Coulter; B23318) bead clean-ups ...
-
bioRxiv - Cancer Biology 2023Quote: ... Enzymatic fragmentation and size selection with the SPRIselect reagent (Beckman Coulter) were used to optimize the cDNA fragment size for sequencing ...
-
bioRxiv - Genomics 2023Quote: ... which was then purified via AMPure XP Reagent (Beckman, Cat # A63880). This proximally-ligated DNA was used to create DNA libraries for sequencing per the Arima Hi-C Library Preparation user guide (Cat # A160141) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The amplicons were purified by Agencourt AMPure XP Reagent (Beckman Coulter, Inc.) according to the KAPA provided protocol ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were purified one more time with SPRISelect reagent (Beckman Coulter, 1.5x). Libraries were quantified using a Qubit fluorimeter (Life technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... libraries were double sided size selected using SPRI select reagent (Beckman Coulter) according to 10x Genomics recommendations ...
-
bioRxiv - Bioengineering 2020Quote: ... The reverse transcription reaction was purified using SPRIselect Reagent (Beckman Coulter, B23317) to obtain purified cDNA ...
-
bioRxiv - Genomics 2023Quote: ... The resulting products were purified for sequencing using SPRIselect Reagent (Beckman Coulter) in a double-sided 0.65X-1X reaction followed by 1X reaction twice ...
-
bioRxiv - Bioengineering 2023Quote: ... Library cleanup was done with SPRI select reagent beads (Beckman Coulter, B23317). Separate libraries were made to detect the nanovial-associated streptavidin oligonucleotide barcode DNA and SEC-seq antibody-conjugated oligonucleotide DNA per cell using the protocol for Cell Surface Protein libraries in the above user guide ...
-
bioRxiv - Immunology 2023Quote: ... it was purified with SPRI beads (Beckman Coulter AMPure XP Reagents, A63882) at a 1:1.8 ratio ...
-
bioRxiv - Immunology 2023Quote: ... The cDNA was purified with SPRI beads (Beckman Coulter AMPure XP Reagents) at a 1:1.8 ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... All PCR products were purified with AMPure XP Reagent (A63881, Beckman Coulter) using standard protocols.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The final library was purified using Agencourt AMPure XP Reagent beads (Beckman Coulter Life Sciences ...
-
bioRxiv - Genomics 2023Quote: ... The library was cleaned using Ampure XP reagent (Beckman Coulter, Indianapolis, IN), following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... After cleanup with AMPure XP Reagent (Beckman Coulter, 1:1 ratio beads:PCR), iPCR amplification was carried out with KAPA HiFi HotStart ReadyMix (Roche) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplified cDNA was fragmented and size-selected using SPRIselect reagent (Beckman Coulter, B23318). i7 indexes as well as P5 and P7 Illumina primers were added to the libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... The final libraries were again purified using the AMPure XP reagent (Beckman Coulter), quantified and normalized prior to pooling ...
-
bioRxiv - Developmental Biology 2022Quote: ... A-tailing and double-sided size selection using SPRIselect Reagent (Beckman Coulter, B23318). P5 and P7 adapters were ligated and individual sample indices provided as a Single Index Plate T Set A (10x Genomics ...
-
bioRxiv - Immunology 2019Quote: ... and products were cleaned up using Dynabeads and SPRIselect reagent (Beckman Coulter; B23318). Indexed libraries were obtained after mixing the barcoded amplicons with the Sample Index PCR Mix and amplified following the next PCR conditions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The amplified library was right side selected using SPRIselect reagent (Beckman catlog # B23317) following their instruction ...
-
bioRxiv - Plant Biology 2020Quote: ... and resulting DNA fragments were purified with AMPure XP reagent (Beckman Coulter, USA). Barcoded sequencing libraries were prepared using NextFlex Rapid DNA-Seq Kits (Bioo Scientific ...
-
bioRxiv - Genetics 2020Quote: ... DNA was then cleaned up using AMPure XP Reagent (Beckman Coulter, cat. A63881) by adding 0.8 x volume of beads to 23 μL PCR reaction ...
-
bioRxiv - Bioengineering 2021Quote: ... the cDNA was cleaned and further purified with SPRIselect reagent (Beckman Coulter, B23318). The final indexed library was constructed following fragmentation ...
-
bioRxiv - Microbiology 2022Quote: ... DNA fragments of 150-400 bp were selected using SPRIselect Reagent (Beckman Coulter). The quality of each library was evaluated using a Fragment Analyzer (Advanced Analytical Technologies ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified with Agencourt AMPure XP cleanup reagent (Beckman Coulter, Brea, CA, USA) to eliminate short (>300 bp ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified using Agencourt AMPure XP cleanup reagent (Beckman Coulter, Brea, CA, USA) to eliminate short (<300 bp ...
-
bioRxiv - Systems Biology 2023Quote: ... The sample underwent a 1x AMPure XP Reagent SPRI clean (Beckman Coulter A63881) and was amplified for another 9 cycles with 8bp indexed PCR primers and purified with a 0.7x SPRI clean (primer 1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC ...
-
bioRxiv - Cancer Biology 2023Quote: ... After enzymatic fragmentation and double size selection using SPRIselect reagent (Beckman Coulter, B23318), unique indexes and P5 and P7 Illumina primers were added to the libraries using Dual Index Kit TT Set A (PN-1000215) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Red blood cells were lysed using Zap-oglobin-II Lytic Reagent (Beckman Coulter) prior to counting splenocytes on a Z1 Beckman Coulter Counter.
-
bioRxiv - Molecular Biology 2024Quote: ... the DNA library was cleaned twice using AMPure XP Reagent (Beckman Coulter, A63881) and eluted to 25 µL by buffer EB ...
-
bioRxiv - Genetics 2020Quote: ... and the resulting libraries were purified with Agencourt AMPure XP Reagent (Beckman Coulter, USA). Diluted libraries (1:100 dilution ...
-
bioRxiv - Genomics 2021Quote: ... replacing reagents SPB and RSB with equal volumes of SPRIselect beads (Beckman Coulter, USA) and ultrapure water (Invitrogen ...
-
bioRxiv - Bioengineering 2020Quote: ... Purified cDNA was PCR amplified and further purified with SPRIselect reagent (Beckman Coulter, B23318). Final libraries were generated after fragmentation ...
-
bioRxiv - Immunology 2020Quote: ... 2.5 uL/well reagent was added with a BioRAPTR FRD (Beckman Coulter, Sykesville, MD), plates were incubated in the dark at ambient temperature for 10 min ...