Labshake search
Citations for Diagenode :
2551 - 2600 of 2740 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Zirconium beads were removed from the cell lysate by centrifugation and the entire cell lysate was subject to sonication using the Bioruptor-Pico (Diagenode) for 3×10 cycles of 30 seconds ON/OFF each resulting in a final median size of chromatin fragments of 200 bp ...
-
bioRxiv - Immunology 2020Quote: ... Nuclear lysates were isolated as previously described22 and sonicated with a Bioruptor (Diagenode) for 8 cycles (GM-BMDMs ...
-
bioRxiv - Immunology 2020Quote: 1.5 ml Bioruptor Microtubes were filled with 250 mg of Protein Extraction Beads (Diagenode) and filled with RIPA buffer (supplemented with protease and phosphatase inhibitors) ...
-
bioRxiv - Immunology 2020Quote: ... sonicated at 4°C with 3 cycles of 30 s on 30 s off in a Bioruptor Pico (Diagenode) and clarified by centrifugation at 12,000 xg ...
-
bioRxiv - Neuroscience 2020Quote: ... using a glass bead sonicator (Diagenode, Denville, NJ, USA). Tubes were centrifuged and the protein extract was aliquoted for multiplex analysis ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tubes were sonicated for 10 mins (sonication cycle: 30 sec ON, 30 sec OFF) at 4 °C in a Bioruptor ultrasonication bath (Diagenode) at high energy setting ...
-
bioRxiv - Developmental Biology 2020Quote: ... Worms were distributed into 15 ml TPX tubes (Diagenode) to reach 200–400 µl worm pellet per tube ...
-
bioRxiv - Microbiology 2020Quote: ... and were sonicated for 20 cycles of 30 sec ON/30 sec OFF (setting high, BioruptorTM Next Gen, Diagenode) to shear DNA to fragments of 100-600 bps ...
-
bioRxiv - Molecular Biology 2020Quote: ... following which sonication was performed using Bioruptor® Plus (Diagenode) at 4°C for 15 min with 30 sec on and 30 sec off ...
-
bioRxiv - Molecular Biology 2020Quote: ... Purified chromatin was sonicated with a Bioruptor (Diagenode) to obtain fragments with a size range between 100 and 500 base pairs ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were vortexed and nuclei were sonicated with a Bioruptor (Diagenode) for 10 minutes on the low setting to solubilize chromatin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The Low cell# ChIPkit protein A × 48 was from Diagenode (Denville, NJ, USA). TaqMan probes for mRNA expression and Chemiluminescence western blot detection reagent were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2020Quote: ... lysed in a Bioruptor (Diagenode) and debris removed by centrifugation ...
-
bioRxiv - Genomics 2020Quote: ... chipped with H3K27ac antibody (DiAGenode, C1541019) after chromatin ...
-
bioRxiv - Genomics 2020Quote: ... H3K27ac Antibody (C15410196, Diagenode, 1:600 ratio) were incubated with 40 µl of Dynabeads protein A/G (Invitrogen ...
-
bioRxiv - Genomics 2020Quote: ... Chromatin fragmentation was performed with the Bioruptor Pico sonicator (Diagenode) for a total sonication time of 4 min (8 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... using the Capture and Amplification by Tailing and Switching method (CATS RNA-seq Kit v2 x24, Diagenode Cat# C05010041, Leige, Belgium). 10ng RNA was used as input and the dephosphorylation step omitted to select for 3’-OH RNA species (miRNA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sonicated (Bioruptor, Diagenode). The protein concentration was determined by Bradford assay ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chromatin was fragmented by shearing in a Bioruptor sonicator (Diagenode) for a total of 30 minutes (high output ...
-
bioRxiv - Molecular Biology 2020Quote: ... samples from multiple ChIP experiments were pooled and sonicated for 15 cycles (30 sec ON, 30 sec OFF, high setting) with a Bioruptor (Diagenode) then concentrated with a vacuum concentrator (Eppendorf) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1x PIC) and sonicated for 30 min using the BioRuptor Pico (Diagenode). Following sonication ...
-
bioRxiv - Immunology 2020Quote: ... and sonicated for 7.5 min (1.5 mL tubes, high power, 30 s on/off cycle, Bioruptor plus, Diagenode). Lysates (20–30 μL ...
-
bioRxiv - Immunology 2020Quote: ... sonicated (Diagenode Bioruptor), and amplified with an Sμ specific biotinylated primer (5’/5BiosG/CAGACCTGGGAATGTATGGT3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... After sonication (30”on/30” off, 10’ total time) in a Bioruptor (Diagenode) to disrupt aggregates ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sheared via sonication on a Bioruptor® UCD-200 (Diagenode) to an average fragment size of 150-300 bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Chromatin immunoprecipitation was performed with iDeal ChIP-seq kit for Histones (Diagenode) following manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... Chromatin was sheared in Shearing buffer iS1 using the Bioruptor Plus (Diagenode) for 20 cycles (each cycle for 30 seconds “ON” and 45 seconds “OFF” ...
-
bioRxiv - Cancer Biology 2020Quote: ... Purified DNA was fragmented to obtain fragments of an average size of 300–400 bp using a Bioruptor Pico (Diagenode; 8 cycles; 20 sec ON/60 sec OFF). 3 μg of DNA per condition were used for library preparation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Chromatin was immunoprecipitated with 10 ug of H3K27Ac antibody (Diagenode cat# C15410196), 10 ug of ASCL1 antibody (abcam ab74065 ...
-
bioRxiv - Cancer Biology 2020Quote: ... ChIP was then performed using H3K27Ac antibody (Diagenode, C1541019)59.
-
bioRxiv - Cancer Biology 2020Quote: ... The sample was then incubated with antibodies (H3K27ac, Diagenode, C15410196 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sample was then incubated with antibodies (H3K27ac, Diagenode, C15410196; H3K27me3, Cell Signaling 9733S; H3K4me3, Diagenode C15410003 premium) coupled with protein A and protein G beads (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... 30 seconds off using a Bioruptor Pico sonicator (Diagenode #B01060010).
-
bioRxiv - Immunology 2020Quote: Chromatin immunoprecipitation was performed using the iDeal ChIP-seq kit for Transcription Factors (Diagenode), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and DNA sheared by sonication (45 cycles; 30 s on/off; Bioruptor Pico, Diagenode) in aliquots (0.2 ml) ...
-
bioRxiv - Neuroscience 2020Quote: Cells were lysed with sonication (Diagenode, UCD-200) in RIPA buffer (Thermo Scientific ...
-
bioRxiv - Neuroscience 2020Quote: Cells were lysed with sonication (Diagenode, UCD-200) in IP buffer (20 mM HEPES ...
-
bioRxiv - Neuroscience 2020Quote: Cells were lysed with sonication (Diagenode, UCD-200) in IP buffer (20 mM HEPES ...
-
bioRxiv - Cancer Biology 2020Quote: ... samples were incubated by rotating overnight at 4°C with primary antibody or irrelevant IgGs and then incubated with protein-A agarose beads (Diagenode; C03020002) previously blocked with 0.5% BSA for 3 hr at 4 °C with rotation ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by immunoprecipation of immunocomplexes with protein-A agarose beads (Diagenode; C03020002) previously blocked with 0.5% BSA for 1 hr at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... The nuclear lysate was sonicated using a Bioruptor sonicator (Diagenode) for 20 cycles of 30 sec on/30 sec off ...
-
bioRxiv - Developmental Biology 2020Quote: ... and sonicated using a Bioruptor sonicator (Diagenode) to achieve DNA fragments between 100-500 bp with a mean fragment size of approximately 300 bp ...
-
bioRxiv - Physiology 2020Quote: ... Resulting nuclei were centrifuged at 12,000 RPM and resuspended in shearing buffer (1% SDS, 10mM EDTA pH 8, 50mM Tris pH8) and sheared in 1.5ml Bioruptor Microtubes (Diagenode, C30010016) in a Bioruptor (Diagenode ...
-
bioRxiv - Physiology 2020Quote: ... in a Bioruptor (Diagenode) for 8 cycles 30 seconds on ...
-
bioRxiv - Genomics 2020Quote: ... and probed with rabbit pAb CRISPR/Cas9 (C15310258, Diagenode, Liège, Belgium, 1:5000), rabbit pAb GFP (ab290 ...
-
bioRxiv - Genetics 2020Quote: ... 2ug rabbit anti-H3K27me3 antibody (Diagenode), 2ug rabbit anti-H3K4me4 antibody (Diagenode ...
-
bioRxiv - Genetics 2020Quote: ... 2ug rabbit anti-H3K4me4 antibody (Diagenode) overnight at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cell lysates were sonicated with a Bioruptor Plus (Diagenode) for 25 cycles (30 seconds ON and 30 seconds OFF) ...
-
bioRxiv - Immunology 2020Quote: ... 30 s OFF at 4°C using a Bioruptor (Diagenode) with intermittent quick vortex and centrifugation using polystyrene tubes ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were sonicated three times in refrigerated BIORUPTOR Plus (Diagenode), 10 cycles 30 sec ON - 30 sec OFF in a Diagenode TPX microtube M-50001 ...