Labshake search
Citations for Macherey-Nagel GmbH :
201 - 250 of 595 citations for 5M Betaine Solution PCR Grade since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were separated by electrophoresis in 1% (w/v) agarose gel and PCR purification was performed with the NucleoSpin PCR purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... All amplified PCR products were isolated using silica membrane spin column technique (NucleoSpin® Gel, PCR clean up kit Macherey-Nagel, Germany) and were eluted in 20 µl of nuclease free water ...
-
bioRxiv - Plant Biology 2021Quote: ... Labelling was performed by PCR using vector-specific DY-682-labelled primers followed by PCR purification with NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL). Gel shifts were visualized using a LiCor Odyssey imaging system at 700 nm.
-
bioRxiv - Microbiology 2020Quote: ... Polymerase chain reaction (PCR) products and plasmid digestion derivatives were purified using NucleoSpin® Gel and PCR Clean-up kits (Macherey-Nagel). Plasmids were extracted from E ...
-
bioRxiv - Synthetic Biology 2021Quote: ... MACS4EPEC and MACS5EPEC was used as template for a PCR with the primers tirDSF and tirDSR and the resulting amplicons were cleaned NucleoSpin® Gel and PCR Clean-up (Macherey-Nagel) and sent for PacBio sequencing ...
-
bioRxiv - Immunology 2021Quote: ... The amplified PCR product is then purified from gel using the “Nucleospin Gel and PCR Clean-up” kit (Macherey-Nagel, Reference: 740609.250).
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were realized using Phusion High-Fidelity DNA Polymerase (ThermoScientific) and PCR products were purified using NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). The overlap PCR product was purified from agarose gel and was directly used to transform wild type F ...
-
bioRxiv - Microbiology 2023Quote: ... The dephosphorylated pEX18Tc vector and PCR products were purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Düren, Germany). TEDA reaction was then carried out by mixing 150 ng of pEX18Tc with the corresponding PCR products at a molar ratio of 1:4 ...
-
bioRxiv - Plant Biology 2023Quote: ... The two resulting PCR products were purified using the NucleoSpin Gel and PCR Clean-up kit (Ref. REF 740609.50; Macherey-Nagel, Düren, Germany), digested at 37°C overnight using FastDigest Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Both gel purifications and PCR clean-ups were performed using the NucleoSpin® PCR and Gel Clean Up Kit (Macherey-Nagel, Germany). DNA concentrations and purities were measured on a NanoDropTM 2000 (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR products and DNA fragments were recovered from agarose gels using NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel, Düren, Germany), and digested using the corresponding restriction enzymes (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR products were gel purified (Macherey-Nagel, USA) and used for ligation reaction ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR products from genotyping were purified (Macherey-Nagel) and sequenced (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR products were purified with Nucleospin (Macherey-Nagel) as per manufacturer’s instructions and sequenced with Sanger sequencing (Eurofins or Genscript).
-
bioRxiv - Microbiology 2021Quote: ... purified (gel and PCR clean-up kit, Macherey-Nagel) and subsequently sequenced by the use of primers oRH068 ...
-
bioRxiv - Genetics 2022Quote: ... PCR products were isolated by gel extraction (Macherey-Nagel) and sequenced with a primer located upstream of the I-SceI cut site (DR-white2 ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... PCR products were purified using NucleoSpin columns (Macherey-Nagel). The library vector pMB1-10x was prepared by restriction digestion with AarI (Thermo Fisher ...
-
bioRxiv - Cell Biology 2024Quote: ... NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Nucleospin Gel and PCR clean-up kit (Macherey-Nagel) was employed to purify DNA from the gel ...
-
bioRxiv - Microbiology 2024Quote: ... NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel) was used to remove contaminants ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The NaOH was neutralized by the addition of 1 M HCl and the cDNA was purified by a PCR-clean-up using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The amplicons were purified from the PCR reagent tube via the NucleoSpin® Gel and PCR Clean-up Kit (Macherey-Nagel, Düren, Germany).
-
bioRxiv - Genomics 2021Quote: ... Gel extraction is performed to isolate the PCR product with the correct size range using the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Düren, Germany). PacBio sequencing library preparation for both libraries was done by the Genomics Core Leuven (KU Leuven) ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR products from genomic DNA and cDNA were purified using NucleoSpin Gel and PCR Clean-up Mini Kit (Macherey-Nagel, Allentown, PA, USA), and quality was validated via agarose gel electrophoresis.
-
bioRxiv - Microbiology 2023Quote: ... Read length was assessed by DNA agarose gel electrophoresis (1% w/v) and amplicons were purified from the PCR mix using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel, Düren, DE) following manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR products were checked out in an agarose gel and purified using NucleoSpin® Gel and PCR Clean-up (Macherey-Nagel, Düren, Germany). Finally ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR fragments were extracted from agarose gels (Macherey-Nagel, 740609.250). pBlueRabbit vector was digested with EagI and XbaI ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or by NucleoSpin Gel and PCR clean-up (Macherey-Nagel). PCR products were sequenced by Genewiz ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products were purified using NucleoSpin® kit (Macherey-Nagel). Plasmids generated ...
-
bioRxiv - Bioengineering 2022Quote: ... NucleoSpin Gel and PCR Clean-up Midi kit (MACHEREY-NAGEL) were used to extract the pooled PCR products from 24 samples in 200 μl of water ...
-
bioRxiv - Microbiology 2020Quote: ... gel purified (Nucleoscopic gel and PCR cleanup kit; Macherey-Nagel), quality checked (BioAnalyzer HS DNA kit ...
-
bioRxiv - Bioengineering 2021Quote: ... or NucleoSpin Gel and PCR Clean-up Kit (Macherey-Nagel). gRNA targeting BFP (gBFP ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were first purified using NucleoSpin kit (Macherey-Nagel) followed by Ampure bead purification (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and purified using the “PCR Clean-up System” (Macherey-Nagel).
-
bioRxiv - Neuroscience 2022Quote: ... concentrated using a PCR cleanup kit (Macherey-Nagel, Düren, Germany), and run on the Illumina NextSeq 500 sequencing platform (Illumina Inc. ...
-
bioRxiv - Neuroscience 2023Quote: ... using the PCR and gel clean-up kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... NucleoSpin Gel and PCR Clean-up Kits (Macherey-Nagel, Germany) were used for DNA clean-up from PCR products and agarose gel extracts ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was purified using the PCR Purification kit (Macherey-Nagel) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and followed with a PCR clean-up (Macherey-Nagel, F40609.250). PCR products and plasmids were restricted with FastDigest BshTI (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified by NucleoSpin Gel and PCR Clean-up (Macherey-Nagel), and cloned into pGEM-T Easy Vector (Promega) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PCR products were purified using NucleoSpin columns (Macherey-Nagel) and eluted into 33 μL water ...
-
bioRxiv - Biophysics 2022Quote: ... and the 3’-terminal poly A) were amplified by PCR and purified using the NucleoSpin™ Gel and PCR Clean-up Kit (Macherey-Nagel™, Düren, Germany) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... PO4 concentrations were analysed after filtering extraction solution (Mn 619 G1/4, Macherey-Nagel) using continuous flow analyser (Seal Analytical ...
-
bioRxiv - Genetics 2021Quote: ... followed by purification (NucleoSpin Gel and PCR Clean-up, Macherey-Nagel). Membranes were washed twice with 2x SSC ...
-
bioRxiv - Bioengineering 2020Quote: ... NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel, Germany) was used for DNA clean-up both from PCR products and agarose gel extracts ...
-
bioRxiv - Cell Biology 2021Quote: ... The product was purified by NucleoSpin PCR clean-up (Macherey-Nagel) and transformed into Escherichia coli ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted using Nucleospin PCR clean-up kit (Macherey-Nagel) and resuspended in 50 μl elution buffer (5 mM Tris-HCl pH 8.5) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA was extracted using a Nucleospin PCR cleanup kit (Macherey-Nagel) and resuspended in 50 μl elution buffer (5 mM Tris-HCl [pH 8.5]) ...
-
bioRxiv - Immunology 2022Quote: ... and purified using NucleoSpin Gel and PCR Clean-up (Macherey-Nagel).