Labshake search
Citations for Macherey-Nagel GmbH :
2051 - 2100 of 2266 citations for Mouse Tryptophan 2 3 Dioxygenase TDO2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The correct bacterial cultures were processed the following day using the NucleoBond Xtra Midi kit for transfection-grade plasmid DNA (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... supernatant was removed and cell pellets were used for plasmid isolation by using NucleoBond□ Xtra Midi Plasmid DNA Purification Kit (Macherey-Nagel) according to the protocol supplied by the kit.
-
bioRxiv - Immunology 2023Quote: RNAs from whole lungs or BM of naive or IAV-infected mice were extracted and purified using the NucleoSpin RNA Extraction Kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were propagated in cultures of terrific broth medium with appropriate antibiotics overnight at 37 °C and purified with NucleoSpin miniprep kit (Macherey-Nagel) following the manufacturer’s prototol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Three independent PCR reactions from the same library were combined after PCR and purified using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Sequencing was carried out on an Illumina HiSeq XTen at Macrogen ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Plant Biology 2024Quote: ... One hundred mg of ground tissue was used for total RNA extraction using NucleoSpin RNA Plant Kit (Macherey-Nagel, Hoerdt, France). After spectrometric quantification with a Nanodrop 2000 ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting fragment was purified using the NucleoSpin Gel and PCR Clean-up kit according to the manufacturer’s instructions (Macherey-Nagel, 740609.250). The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cells at the indicated time points post stimulation and/or infection using the NucleoSpin RNA extraction kit (Macherey-Nagel) as directed by manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted using NucleoSpin RNA Plant Kits and DNase I treatment according to the manufacturer’s instructions (Macherey-Nagel, Germany). Complementary DNA (cDNA ...
-
bioRxiv - Immunology 2021Quote: ... Positive clones were identified by colony PCR and the plasmids were isolated using NucleoSpin® Plasmid EasyPure kit (Macherey-Nagel, Düren, Germany). The DNA sequence of the cloned devil CIITA transcript was verified by Sanger sequencing using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems (ABI) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid DNA was purified from the remaining cultures using a NucleoSpin Plasmid (NoLid) high-pure plasmid mini prep kit (cat. no. 740499.50, Macherey-Nagel, Bethlehem, PA) according to vendor instructions and quantified using the Qubit dsDNA BR Assay (cat ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... we removed the last segments of the caudal section and preserved it in 96% ethanol before DNA extraction using the NucleoSpin® 96 Tissue kit (Macherey-Nagel). It is worth noting that the ablation of the last segments of the caudal section of earthworms does not affect their survival due to their regeneration capacity (e.g ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was extracted from 50 to 250 EB collected at different time points using the NucleoSpin® RNA kit (Macherey-Nagel) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: Genomic sequences of the StGBSSI gene (Gene ID from NCBI: 102577459) were obtained from leaf DNA extracted using the NucleoSpin Plant II kit (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... 8 pairs of ovaries were dissected from 6 day-old virgin females and total RNA were extracted using the NucleoSpin® RNA isolation kit (Macherey-Nagel), following the instructions of the manufacturer ...
-
bioRxiv - Genomics 2021Quote: ... embryos were ground in Tri-Reagent and RNA was purified using affinity chromatography (Nucleospin RNA Clean up kit, Macherey-Nagel, Duren, Germany). Potential contaminating DNA was removed by digestion with rDNase then RNA was purified using Beckman Coulter’s solid-phase reversible immobilization (SPRI ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was successfully extracted from pelvic fin tissue of 238 individuals (85.6%) out of 278 collected in August 2015 (i.e. survivors and non-survivors) using NucleoSpin® RNA kit (Macherey-Nagel, Düren, Germany) and ensuring RNA quality using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Microbiology 2021Quote: ... mitochondrial and nuclear genomes we extracted genomic DNA from Pb-GFP infected hepatocytes treated or not with infusion using a NuceolSpin Tissue kit (Macherey-Nagel, Germany) according to manufacturer’s manual ...
-
bioRxiv - Neuroscience 2020Quote: ... Gel extraction was performed to select for products between 200 – 1000 bp using the Nucleospin Gel and PCR Clean-up kit (Macherey-Nagel, 740609). Samples were eluted in 11 μL NF H2O ...
-
bioRxiv - Cancer Biology 2020Quote: ... All amplified PCR products were isolated using silica membrane spin column technique (NucleoSpin® Gel, PCR clean up kit Macherey-Nagel, Germany) and were eluted in 20 µl of nuclease free water ...
-
bioRxiv - Plant Biology 2021Quote: ... Labelling was performed by PCR using vector-specific DY-682-labelled primers followed by PCR purification with NucleoSpin® Gel and PCR Clean-up kit (MACHEREY-NAGEL). Gel shifts were visualized using a LiCor Odyssey imaging system at 700 nm.
-
bioRxiv - Cell Biology 2021Quote: ... Eluates were digested with proteinase K and RNAse A and DNA fragments were purified using a PCR purification kit (Macherey-Nagel, #740609).
-
bioRxiv - Microbiology 2020Quote: ... 200 μL of the permeabilized sample was then processed using the Machery-Nagel NucleoSpin Virus kit (Macherey-Nagel, Catalog # 740983.50 and 740983.250).
-
bioRxiv - Microbiology 2020Quote: ... Clonal virus populations were characterized by isolating viral RNA from 150 µl aliquots of the cell culture supernatant with the NucleoSpin® RNA Virus kit (MACHEREY-NAGEL) followed by conventional RT-PCR and bidirectional Sanger sequence analysis.
-
bioRxiv - Zoology 2021Quote: ... standard DNA extraction was performed using the NucleoSpin™ Plant II DNA extraction kit (Macherey-Nagel GmbH and Co., Düren NRW, Germany). A reasonable number (usually 30–70 ...
-
bioRxiv - Microbiology 2022Quote: ... Viral genome equivalents (vge) were determined by qPCR of DNA isolated from encapsidated virions isolated with NucleoSpin Blood kit QuickPure (Macherey-Nagel; 740569.250).
-
bioRxiv - Plant Biology 2021Quote: ... total RNA was extracted from root tissues of DKC-9144 and PG-2475 at three time points (15, 25 and 35 DAS) with or without PBZ using Nucleospin RNA plant kit (Pal et al., 2017) (Macherey-Nagel, Germany). cDNA synthesis and qPCR was performed as described previously (Pal et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the band with the expected size excised and purified using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel). The second PCR products were sent for Sanger sequencing to Eurofins Genomics and checked for quality ...
-
bioRxiv - Microbiology 2020Quote: ... Polymerase chain reaction (PCR) products and plasmid digestion derivatives were purified using NucleoSpin® Gel and PCR Clean-up kits (Macherey-Nagel). Plasmids were extracted from E ...
-
bioRxiv - Microbiology 2020Quote: ... lung left inferior lobe from hamsters were cut into pieces and lysed with RA1 lysis buffer provided with the NucleoSpin® RNA Plus kit (Macherey-nagel), RNA extraction was performed according the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: gDNA from 6 male and 5 female pupae (sexed by eye) was extracted using the NucleoSpin Tissue kit (Macherey-Nagel, Düren, Germany), pooled by sex and used as template for subsequent PCRs ...
-
bioRxiv - Genetics 2022Quote: RNA extraction was performed from frozen tissue in culture plates (P6 well plate, Falcon®) by using the NucleoSpin RNA kit (Macherey-Nagel). RNA concentration was measured with NanoDrop1000 spectrophotometer (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: Cells pellet (1.5*10^6) were collected at different time points after LPS stimulation and DNA was extracted with the Nucleospin tissue kit (Macherey-Nagel, 740952). The genomic DNA was eluted in 50 μl of BE buffer (5 mM Tris/HCl ...
-
bioRxiv - Bioengineering 2020Quote: Standard methods were used to determine the TSS and volatile suspended solids concentration.25 The COD was measured using test kits (Macherey-Nagel, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... RNA extraction was performed using a modified protocol of the NucleoSpin 96 RNA tissue kit (Macherey-Nagel Gmbh&Co. KG, Düren, Germany) and using a vacuum system [12] ...
-
bioRxiv - Genomics 2020Quote: ... Cleaved Histone-DNA complexes were isolated by centrifugation and DNA was extracted with a NucleoSpin PCR Clean-up kit (Macherey-Nagel, 740609).
-
bioRxiv - Zoology 2020Quote: Approximately 50-100 mg of tissue (from the second pereopod) was used for DNA extraction using the NucleoSpin® Tissue Kit (Macherey-Nagel) following the instructions of the manufacturer ...
-
bioRxiv - Genomics 2019Quote: ... while total RNA was extracted using the Nucleospin RNA plant kit with the protocol modified for maximum yield (Macherey-Nagel, Oensingen, Switzerland). RNA concentration was determined with a Qubit 3.0 (Thermofisher).
-
bioRxiv - Plant Biology 2019Quote: Total RNA from 4 week old Arabidopsis WT Col-0 and mtamutants28 was extracted as described above followed by polyA enrichment using NucleoTrap® mRNA isolation kit (Macherey-Nagel). Immunoprecipitation was performed with EpiMark N6-Methyladenosine Enrichment Kit (NEB ...
-
bioRxiv - Neuroscience 2021Quote: Viral biodistribution analysis - Genomic DNA (gDNA) was extracted from the brain region of interest with the NucleoSpin®Tissue Kit (Macherey-Nagel) extraction kit and 100 ng of gDNA was used as a qPCR template ...
-
bioRxiv - Microbiology 2020Quote: We extracted DNA from the biomass pellets stored at −20°C using a NucleoSpin® Microbial DNA Kit (Macherey-Nagel, Düren, Deutschland), according to the manufacturer’s protocol ...