Labshake search
Citations for Macherey-Nagel GmbH :
2051 - 2100 of 2292 citations for Bicinchoninic Acid BCA Protein Assay Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from 15 unsexed individuals conserved in alcohol using the Nucleobond AXG20 kit and buffer set IV from Macherey-Nagel (ref ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... total RNA was extracted from two pools of four entire emerging female wasps using the NucleoSpin®RNA kit (Macherey-Nagel). Total RNA was finally resuspended in 40µL of RNAse free water ...
-
bioRxiv - Evolutionary Biology 2023Quote: Whole DNA was extracted from fecal samples following the optimized protocol of (79) using the Genomic DNA from soil kit (NucleoSpin, Macherey-Nagel). Two successive extractions were done and a purification step was added to retrieve high molecular weight DNA suitable for long-read sequencing (79) ...
-
bioRxiv - Genomics 2023Quote: Total RNA was extracted from immature inflorescences (stages 1-12) or aerial parts of 16- day-old seedlings using NucleoSpin RNA Plus kit (Macherey-Nagel) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The cloned BAC DNA was extracted using NucleoBond Xtra BAC kit for large construct plasmid DNA (Macherey-Nagel, catalog number 740436.25). For library cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and 16S amplicons (500 bp amplicon size) were purified by agarose gel separation using the NucleoSpin Gel and PCR Clean-up purification kit (Macherey-Nagel). Bacterial 16S amplifications were obtained using the FastStart High-Fidelity PCR system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... DNA purification from agarose gel or enzymatic reactions was performed with the NucleoSpin Gel and PCR clean up kit (Macherey-Nagel). PCRs were performed with Phusion DNA polymerase (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The correct bacterial cultures were processed the following day using the NucleoBond Xtra Midi kit for transfection-grade plasmid DNA (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... homogenized and frozen on dry ice in 350 μl of Buffer RA1 containing BME (Macherey-Nagel Nucleospin RNA isolation kit 740955), and stored at –80°C ...
-
bioRxiv - Bioengineering 2023Quote: ... supernatant was removed and cell pellets were used for plasmid isolation by using NucleoBond□ Xtra Midi Plasmid DNA Purification Kit (Macherey-Nagel) according to the protocol supplied by the kit.
-
bioRxiv - Microbiology 2023Quote: Genomic DNA of tick organs and eggs was extracted using the NucleoSpin Tissue kit according to the manufacturer’s instructions (Macherey-Nagel, Germany). DNA was eluted with 50 μL of elution buffer and was stored at -20°C until use.
-
bioRxiv - Evolutionary Biology 2023Quote: ... Three independent PCR reactions from the same library were combined after PCR and purified using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Sequencing was carried out on an Illumina HiSeq XTen at Macrogen ...
-
Prevention of tau accumulation through inhibition of hnRNP R-dependent axonal Mapt mRNA localizationbioRxiv - Neuroscience 2023Quote: ... Total RNA was extracted from the input sample and beads by adding 300 μl buffer A1 (NucleoSpin RNA kit, Macherey-Nagel) and 300 μl absolute ethanol followed by RNA extraction according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: RNA was isolated from T-REx-293 and A549 cells using the NucleoSpin RNA Mini kit for RNA purification (Macherey-Nagel). 500 ng of total RNA was used for cDNA synthesis using Maxima™ Reverse Transcriptase (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... and 300 mg (JFC) of both fresh and treated frass (n = 3) using the NucleoSpin Soil Kit (Macherey-Nagel, Düren, Germany) and following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was prepared from isolated colonic epithelial cells of Hsp60Δ/ΔIEC and Hsp60fl/fl mice on day 2 with the column-based NucleoSpin RNAII kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... using mouse genomic DNA as a template and primer pairs 5’CAAAGAGCTCCTCGTCCAGT3’ and 5’ ATGGACTCCAGGACCCAAGA3’ followed by a column purification using the NucleoSpinⓇ Gel and PCR Clean-up Kit (Macherey-Nagel). For the in vitro cleavage assay ...
-
bioRxiv - Plant Biology 2024Quote: ... glycines J2 worms following treatment with CPR1-dsRNA or GFP-dsRNA control using the Nucleospin microRNA kit (Macherey-Nagel, Hoerdt, France). First-strand cDNA was synthesized and served as a template for PCR ...
-
bioRxiv - Immunology 2024Quote: ... and immediately transferred to a tube containing 400 µL of RA1 lysis buffer from the Nucleospin 96 RNA core kit (Macherey-Nagel) and ∼20 1-mm glass beads (BioSpec) ...
-
bioRxiv - Immunology 2024Quote: ... The DNA donor fragment was PCR amplified and cleaned up prior to injection using the Gel & PCR Clean-Up Kit (Macherey-Nagel). One cell stage zebrafish embryos were injected with ∼1-2 nl of 2.5 ng/μl DNA donor fragment together with 12.5 ng/μl sgRNA (GGACAATTTTCATGACAAGA ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the resulting fragment was purified using the NucleoSpin Gel and PCR Clean-up kit according to the manufacturer’s instructions (Macherey-Nagel, 740609.250). The purified CASP3 gene fragment was ligated into the linearized pEGFP-N3 vector using the quick ligationTM kit according to the manufacturer’s instructions (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... Single colonies were grown in 5 ml liquid LB medium at 37 °C overnight and the plasmid DNA was extracted using NucleoSpin® Plasmid preparation kit according to the manufacturer’s instructions (Macherey-Nagel). Positive clones were identified by restriction digestion and DNA sequencing ...
-
bioRxiv - Microbiology 2024Quote: The genomic ssDNA was isolated from the ion exchange-purified sample of the phage using a Virus DNA kit (Macherey-Nagel). For sequencing on the Oxford Nanopore platform ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from cells at the indicated time points post stimulation and/or infection using the NucleoSpin RNA extraction kit (Macherey-Nagel) as directed by manufacturer ...
-
bioRxiv - Plant Biology 2024Quote: ... One hundred mg of ground tissue was used for total RNA extraction using NucleoSpin RNA Plant Kit (Macherey-Nagel, Hoerdt, France). After spectrometric quantification with a Nanodrop 2000 ...
-
bioRxiv - Genomics 2024Quote: Total RNA was extracted from 100 mg of rosette leaves from ddm1-2 plants using the Nucleo-spin RNA Plant mini kit (Macherey-Nagel). Library preparation and Nanopore sequencing were performed as previously described (Domínguez et al ...
-
bioRxiv - Plant Biology 2024Quote: Total RNA was isolated from different tissues (leaf, xylem, phloem, and root) using a commercial RNA isolation kit (Macherey-Nagel, Germany). According to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was extracted using NucleoSpin RNA Plant Kits and DNase I treatment according to the manufacturer’s instructions (Macherey-Nagel, Germany). Complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... The PCR products were run on a 2% agarose gel and purified from gel using a NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). The DNA concentration of the samples was measured and samples were diluted to 1 ng/μL in 10 μL ...
-
bioRxiv - Physiology 2024Quote: ... They were linearized with the PacI restriction enzyme and purified with the NucleoSpin Gel and PCR Clean-up kit (Macherey-Nagel). Finally ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA purification was performed with NucleoMag kit for clean-up and size selection using NucleoMag SEP Mini separation plate (Macherey-Nagel). 4 ng of isolated DNA were used to complete the libraries by attaching indexes with xGen NXT UDI Primers (IDT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Positive colonies were inoculated into 5 ml of LB medium with kanamycin (50 μg.mL−1) for overnight cultures at 30°C in order to isolate cloned plasmids using the Nucleospin plasmid kit (Macherey-Nagel). Identities of the cloned sequences were confirmed by Sanger sequencing using pHREAC sequencing primers (Table S6) ...
-
bioRxiv - Bioengineering 2024Quote: ... The PCR product was run on a 1% agarose gel and subsequently purified using the NucleoSpin Gel and PCR Cleanup kit (Macherey-Nagel) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... PCR products for each single cell clone were combined and purified using the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel). Afterward using a second round of PCR ...
-
bioRxiv - Microbiology 2024Quote: ... followed by capillary sequencing to identify positive clones from which plasmid DNA was purified in preparation for transfections using a midi prep kit (Macherey-Nagel).
-
bioRxiv - Evolutionary Biology 2024Quote: DNA was extracted from ∼20 mg of dry herbarium plant material using the NucleoSpinⓇ Plant II kit (Macherey-Nagel, Düren, Germany), following the manufacturer’s manual with slight modifications ...
-
bioRxiv - Synthetic Biology 2024Quote: ... PCR products were run on 1% agarose gel stained with 1X SYBR-Safe (Thermo) and extracted using the NucleoSpin Gel and PCR Cleanup Kit (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNA from MCF7 cells was obtained with a Macherey-Nagel™ Total RNA Isolation kit (Macherey-Nagel, Germany, Cat # 740955.50) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Amplified DNA was excised and purified from a 1% agarose gel using the NucleoSpin Gel & PCR Clean-up Mini kit (Macherey-Nagel). The target vector (pCW57-GFP-P2A-MCS ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The fragments were separated by electrophoresis in 1% (w/v) agarose gel and PCR purification was performed with the NucleoSpin PCR purification kit (Macherey-Nagel) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: RNA from muscle and bone marrow samples collected in Brussels was extracted separately using the Nucleospin® RNA kit (Macherey-Nagel) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... the band of correct size was excised under 70% UV light using a clean scalpel and DNA was extracted using Nucleo Spin Gel and PCR Clean-up Kit (Macherey-Nagel). DNA sequences were confirmed by sequencing ...
-
bioRxiv - Genomics 2024Quote: The embryos used for RT-qPCR were directly transferred to the RA1 buffer supplemented with 2-Mercaptoethanol provided with the NucleoSpin RNA kit (Macherey-Nagel) and stored at -80°C for further RNA extraction.
-
bioRxiv - Cancer Biology 2024Quote: RNA was isolated from A375-C and A375-Cx43 untreated cell lines and under BRAF/MEKi (dabrafenib and trametinib) treatment (n=4, each condition) using the Kit RNA isolation: NucleoSpin RNA (Macherey-Nagel). Quality and integrity of each RNA sample was checked using a Bioanalyzer 2100 instrument (Agilent ...
-
bioRxiv - Biochemistry 2024Quote: ... and the desired band was excised and purified using the NucleoSpin Gel and PCR Cleanup Kit (Macherey-Nagel, catalog no. 740609) following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2024Quote: RNA from whole colon Swiss roll sections stored in Optimal cutting temperature (OCT) compound was isolated with the NucleoSpin RNAII Kit (Macherey-Nagel) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA expression plasmids were extracted and were purified from bacterial cells with NucleoBond® Extra Midi Plus kit (Macherey-Nagel, Germany) and they were stored at -20°C until their use for transient transfection into mammalian cells.
-
bioRxiv - Cell Biology 2024Quote: ... The cloned gRNA + pSpCas9(BB)-2A-Puro V2.0 constructs were then isolated from the bacterial culture using a plasmid isolation kit (Macherey-Nagel, #740588.50). Following isolation ...
-
bioRxiv - Genetics 2024Quote: ... DNA was extracted from fresh leaves using the NucleoSpin Plant II Mini kit for DNA from plants (Macherey-Nagel, Duren, Germany) and sequenced using the HiSeq 4000 sequencing system (Illumina Inc. ...
-
bioRxiv - Immunology 2021Quote: ... Positive clones were identified by colony PCR and the plasmids were isolated using NucleoSpin® Plasmid EasyPure kit (Macherey-Nagel, Düren, Germany). The DNA sequence of the cloned devil CIITA transcript was verified by Sanger sequencing using Big Dye™ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems (ABI) ...