Labshake search
Citations for Bio-Rad :
151 - 200 of 10000+ citations for Thioredoxin Domain Containing Protein 3 TXNDC3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2020Quote: ... Membranes were washed 3 times in TBSt and then incubated with HRP secondary antibodies (anti-Mouse HRP, Biorad, 170-6516 ...
-
bioRxiv - Biochemistry 2023Quote: ... membranes were washed 3 times in TBS-T and incubated for 45 minutes with secondary antibody (Bio-Rad: Goat Anti-rabbit #1706515 or Goat-anti mouse #1706516) ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were detected using secondary HRP-conjugated α-mouse antibody and enhanced chemiluminesence reagent (Bio-Rad).
-
Redundant and specific roles of cohesin STAG subunits in chromatin looping and transcription controlbioRxiv - Cell Biology 2019Quote: ... 20 mg of antibody were loaded on 50 µl Affi-Prep® Protein A Resin (Biorad) (multiply this with the number of 2nd CHIP’s planned and plan one sample to check the ChIP efficiency of the 1st ChIP step) ...
-
bioRxiv - Neuroscience 2019Quote: ... three sections of tissue were stained with antibodies against proteolipid protein (MCA839G; Bio-Rad; 1:1000) and imaged at a spatial resolution of 0.28 µm/pixel ...
-
bioRxiv - Cancer Biology 2022Quote: ... the lysates were incubated with primary antibody conjugated SureBeads Protein G Magnetic Beads (Bio-Rad Laboratories) for 1 hour rotating at room temperature ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteins were probed with either secondary antibodies goat anti-mouse-HRP (Bio-Rad, 1706516, 1:5000) or goat anti-rabbit-HRP (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynabeads-bound antibody-proteins (IP samples) were eluted with 1x Laemmli Sample Buffer (1610737EDU, Bio-Rad) for 20 min at 65°C while shaking at 1000 rpm in ThermoMixer F1.5 (Eppendorf) ...
-
bioRxiv - Cancer Biology 2023Quote: ... conjugated antibodies was used to detect desired protein by chemoluminescence with ECL (Bio-Rad, #170-5061). For immunoprecipitation ...
-
Dual signaling via interferon and DNA damage response elicits entrapment by giant PML nuclear bodiesbioRxiv - Microbiology 2021Quote: ... Proteins were separated on SDS-containing 8 to 12 % polyacrylamide gels and transferred to PVDF membranes (Bio-Rad Laboratories, Inc., Hercules, USA). After staining with primary and secondary antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... Gels were loaded with samples containing 10 μg total protein before electrophoresis on a 16.5% Tris Tricine gel (Bio-Rad, Hercules, CA). Gels were stained with the Pierce Silver Stain kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Band intensities of at least 3 individual experiments were measured densitometrically and normalized to whole protein using the Image Lab Software 5.1 from BioRad (Biorad, Munich, Germany).
-
bioRxiv - Immunology 2024Quote: ... cells were lysed in buffer containing 1% NP-40 and proteins were separated using SDS-PAGE (Mini-PROTEAN® TGX™ Precast Gels, Bio-Rad), transferred to low fluorescence PVDF membranes (Bio-Rad) ...
-
bioRxiv - Immunology 2019Quote: ... The immuno-reactive proteins positive for TLR antibody were visualized/detected by chemiluminescence documentation system (BioRad, U.S.A.). Finally signal intensities were measured using NIH Image J software.
-
bioRxiv - Biochemistry 2022Quote: ... Proteins reacting with antibodies were detected with ECL Prime (Citiva) and visualized with ChemiDoc Touch (Bio-Rad). Acquired images were processed using Image Lab 5.2.1 (Bio-Rad ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were washed 3 x 10min in TBS + Tween 20 before proteins were detected by Immuno-Star luminol-peroxide (Bio-Rad, #170-5070). Bio-Rad Chemi-doc was used to visualize and quantify proteins with densitometry.
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2023Quote: ... The membrane was then washed thrice for 5 mins in PBS-Tween 20 before incubation with an HRP-conjugated anti-mouse secondary antibody (1:1000) and streptactin antibody (specific to the standard protein marker – Bio-Rad, Cat# 1610376; 1:1000 dilution) for 1 h at room temperature ...
-
bioRxiv - Bioengineering 2024Quote: ... the membrane was incubated with HRP-conjugated anti-mouse secondary antibody (1:1000) and streptactin antibody (specific to the standard protein marker – Bio-Rad, Cat# 1610376; 1:1000 dilution) for 1 h at 25°C before washing it six more times ...
-
bioRxiv - Developmental Biology 2021Quote: ... containing β-mercaptoethanol (BioRad). Boiled samples and protein marker (Bio-rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Nuclear extracts containing the total of 40 µg protein were separated on a 10% Tris-SDS PAGE gel (Bio-Rad Mini-PROTEAN® TGX). Gels were transferred on nitrocellulose membranes using Bio-Rad TransBlot system ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein extracts (50 μg of protein) in β-mercaptoethanol containing SDS sample buffer were separated in 4% to 12% gradient SDS-polyacrylamide gels (Bio-Rad #456-8094) and transferred to nitrocellulose membranes (Bio-Rad #170-4271 ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein extracts (50 µg of protein) in β-mercaptoethanol containing SDS sample buffer were separated in 4% to 12% gradient SDS-polyacrylamide gels (Bio-Rad #456-8094) and transferred to nitrocellulose membranes (Bio-Rad #170-4271 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Depletion of biotinylated proteins from lysates was confirmed by immunoblotting using Streptavidin HRP antibody (STAR 5B, Bio-rad).
-
bioRxiv - Cell Biology 2024Quote: ... Antibodies were purified from rabbit serum by affinity chromatography using Affi-Prep protein A resin cartridge (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... PVDF membranes were washed three times with tween 20-containing tris buffered saline before incubation with HRP-conjugated secondary antibodies (Bio-Rad). Images were detected using a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... the membranes were washed 3 times for 5 min and incubated with the secondary antibodies (1:10000, IgG-HRP, Bio-Rad) for 45 min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Membranes were washed a further 3 times in TBS-T and bound antibodies were visualised using the Clarity Western ECL substrate (BioRad; #1705061) with a ChemiDoc MP system (BioRad) ...
-
Comprehensive mutational analysis of the checkpoint signaling function of Rpa1/Ssb1 in fission yeastbioRxiv - Genetics 2023Quote: ... the membrane was blotted with the Chk1-pS345 antibody at the 1:3000 dilution for 3 h to detect the phosphorylated Chk1-Ser345 in ChemiDoc (Bio-Rad). The membrane was stripped ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supernatants were transferred to new tubes containing 87% glycerol (final concentration of 10%) and concentrations were adjusted using Bio-Rad protein assay (Bio-Rad, Hercules, California, United States).
-
bioRxiv - Genomics 2022Quote: ... denatured proteins and Precision Plus Protein™ Dual Xtra Prestained Protein Standards (Biorad 1610377) were loaded into 16.5% Mini-PROTEAN® Tris-Tricine Gels (Biorad 4563066 ...
-
bioRxiv - Microbiology 2022Quote: ... Total protein was determined in all samples by Protein Assay (Protein Assay II, BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2023Quote: ... Protein concentration was estimated by Lowry’s protein assay method (DC™ Protein Assay, BioRad).
-
bioRxiv - Microbiology 2023Quote: ... Aliquots of clarified lysate (3 x 106 parasite equivalents) were resolved by SDS-PAGE (Mini-PROTEAN®TGX protein gel; Bio-Rad, Hercules, California, USA), transferred to PVDF membrane (Immobilon®-FL ...
-
bioRxiv - Microbiology 2020Quote: ... Precision Plus Protein Unstained Protein Standards (Bio-Rad) were used as molecular weight markers ...
-
bioRxiv - Microbiology 2022Quote: ... Precision Plus Protein Kaleidoscope Prestained Protein Standard (BioRad) was used as molecular weight standard.
-
bioRxiv - Cell Biology 2020Quote: ... supernatant fractions were subjected to immunoprecipitation with anti-Pex14 antibody immobilized on SureBeads Protein G magnetic beads (Bio-Rad) for 3 h at 4°C with rotation ...
-
bioRxiv - Microbiology 2022Quote: ... the samples were washed extensively with lysis buffer and the proteins were eluted by boiling 5 ul of the resin with 5x SDS loading buffer and the proteins were detected by western blot analysis using rabbit antibody to FLAG (1:2,000, BioRad) or mouse antibody to Myc (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... 1mg cell lysate or 500 µg cytosolic or nuclear fraction were incubated with 2μg antibody or normal IgG and pulled down by 5µL protein G-magnetic beads (Bio-Rad). Samples were then pulled down by protein-G-magnetic beads and subjected to WB or proteomics analysis ...
-
bioRxiv - Molecular Biology 2024Quote: ... Proteins were visualized using fluorescent secondary antibodies and quantified using ChemiDoc MP device (Bio-Rad Laboratories, Hercules, CA, USA) and quantified with Image Lab software (version 6.0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein bands were treated with appropriate antibodies for detection and analyzed using a ChemiDoc XRS+ image analyzer (Bio-Rad). Band intensity was measured using Quantity One software (Bio-Rad) ...
-
bioRxiv - Cell Biology 2024Quote: Anti-Flag antibody precipitated proteins in the concentrated eluate were resolved in a 4-15% Criterion TGX gel (BioRad) and stained by Colloidal Blue dye (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...