Labshake search
Citations for Bio-Rad :
101 - 150 of 370 citations for Recombinant Human Long Arg3 Insulin like Growth Factor I since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the Bio-Plex Pro mouse cytokine assay (23-Plex Group I; Bio-Rad) was used on a Luminex-xMAP/Bio-Plex 200 System with Bio-Plex Manager 6.2 software (Bio-Rad) ...
-
bioRxiv - Neuroscience 2023Quote: ... See product details for full description (Bio-Rad Protein Assay Kit I #5000001). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... The real time PCR analysis was achieved with an i-Cycler (BIO-RAD) using the following reaction conditions ...
-
bioRxiv - Neuroscience 2023Quote: The supernatant was quantified using DC™ Protein Assay Kit I (Biorad, #5000111) and samples were diluted to a final concentration of 500 µg/mL ...
-
bioRxiv - Physiology 2024Quote: ... Contaminating DNA was removed by treating the samples with DNase I (Bio-Rad). 500 ng RNA was used for reverse transcription using iScript reagent (Bio-Rad) ...
-
bioRxiv - Biochemistry 2022Quote: ... The αM and β2 subunits of recombinant Mac-1 integrin were resolved on 4-20% polyacrylamide (BioRad), gradient gels by SDS-PAGE and stained with Coomassie brilliant blue R250 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel carrying the recombinant proteins and their derivatives was eventually stained with Coomassie Blue (Bio-Rad) for 1 hour and was de-stained with a de-staining solution (20% methanol and 10% acetic acid in water).
-
bioRxiv - Neuroscience 2021Quote: ... PAI-1 and insulin) from plasma samples were analyzed by duplicate using the Bio-PlexPro mouse Diabetes group from Bio-Rad (Ref. 171F7001M) by Luminex® 200TM technology as previously described (Ortega Moreno et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... and metabolic biomarkers of insulin resistance from plasma samples were both analyzed by duplicate using the Bio-PlexPro mouse Diabetes group from Bio-Rad (Ref. 171F7001M), in a Luminex® 200™ technology as previously described (Ortega Moreno et al ...
-
bioRxiv - Cell Biology 2023Quote: ... overnight at 4°C in a humidified chamber with the following primary antibodies: Guinea-pig anti-Insulin antibody (Biorad 5330-0104G, 1:250). Following overnight incubation ...
-
bioRxiv - Immunology 2019Quote: ... we measured bacterial growth by detection of luminescence at λ = 470 using a Spectramax L luminometer (Bio-Rad) or by dilution of infected cultures on BYCE agar plates for enumeration of CFU ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell growth and viability were monitored daily by Trypan blue using a TC10 automated cell counter (BIO-RAD). Each experiment was performed three times.
-
bioRxiv - Microbiology 2020Quote: ... growth media was removed from cells and cell extracts prepared by lysis in SDS sample buffer (Bio-Rad) supplemented with β-mercaptoethanol (Sigma) ...
-
Methacrylic acid-based biomaterials promote peripheral innervation in the subcutaneous space of micebioRxiv - Bioengineering 2022Quote: ... explanted tissues were embedded in histogel followed by paraffin and cut on edge in 200μm sections and stained for nerve growth (PGP9.5; Biorad). Processed slides were scanned at 20X at the Advanced Optical Microscopy Facility (MaRS ...
-
bioRxiv - Developmental Biology 2020Quote: Levels of PAI1 in human plasma were measured using a Bio-Plex multiplex enzyme immunoassay (Customized Human Cancer Biomarker Assay, Bio-Rad Laboratories). Plasma was diluted 1:4 in assay diluent prior to performing the assay ...
-
bioRxiv - Microbiology 2020Quote: ... Cell culture supernatants were screened for the presence of 27 human cytokines and chemokines using the Bio-Plex Pro Human Cytokine Standard 27-Plex kit (Bio-Rad Laboratory) on a FLEXMAP 3D® analyzer (Luminex ...
-
bioRxiv - Biochemistry 2023Quote: ... The culture medium after incubation was analyzed for the presence of secreted human cytokines using Bio-Plex Pro Human Cytokine 17-plex Assay (Bio-Rad, USA) and Bio-Plex 200 Systems (Bio-Rad ...
-
bioRxiv - Immunology 2021Quote: ... Conjugates against anti-human IgG-HRP (BioRad, Richmond, CA) or anti-human IgA-HRP (Nordic BioSite ...
-
bioRxiv - Cancer Biology 2020Quote: ... with certified human GAPDH and LOX primers (Bio-Rad). The reaction was run in CFX Connect 96 Real Time PCR system (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Total Human GAPDH (BioRad, USA, 171V60019M), Bio-Plex Pro Total β-Actin (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX-labelled human reference assay (dHsaCP1000001, BioRAD), 1/40 HindIII (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1× AP3B1-HEX labelled human reference assay (Bio-Rad), 1/40 HaeIII (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant protein purities were assessed by SDS-PAGE using 4-20% Mini-Protean TGX gels (Bio-Rad, #4561094) and quantified using the BCA Protein Estimation kit (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... The real-time PCR reaction mixture contained i-Taq SYBR green master mix (BioRad), 0.6 mM primer pairs ...
-
bioRxiv - Plant Biology 2020Quote: ... The PCR was performed using the high-fidelity DNA polymerase “I proof” (Bio-Rad). The full genomic fragments were cloned into the pDONR221 (Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... pH 7.5) and assayed for total protein content (Protein Assay Kit I, Bio-Rad). The protein was then precipitated in 80% acetone at −20°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and loaded onto a 2 ml CHT2-I hydroxyapatite column (Bio-Rad) equilibrated in 20 mM HEPES ...
-
bioRxiv - Physiology 2022Quote: ... The densitometry of western blots was performed using I Image Lab (BIO-RAD USA).
-
bioRxiv - Biophysics 2023Quote: ... 5 µl of protein samples and standards (Protein Standards I and II, Bio-Rad) were added to 25 µl reagent A’ and mixed in the wells of a 96 well plate (Corning Costar) ...
-
bioRxiv - Molecular Biology 2020Quote: ... A gate was established for each factor using negative control samples stained with mouse IgG1 negative control antibodies (BIO-RAD, MCA928) or polyclonal rabbit IgG (R&D Systems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... while insulin levels were assayed using the quantitative Bio-Plex Pro™ Mouse Diabetes 8-Plex immunoassay (#171F7001M; Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... Every 24 hours cell growth and viability of cells were determined using a TC20 cell counter (Bio-Rad Laboratories). At 72 hours post inoculation ...
-
bioRxiv - Microbiology 2021Quote: Viral stocks or supernatant from DENV growth curves at 120hpi were diluted with 4x Laemmli Sample Buffer (Bio-Rad) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... cell media was replaced with 200 uL growth assay media (180 uL DME + 20 uL Alamar Blue (BioRad BUF012A), and incubation was continued for 4 hr at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... goat anti-human IgG Fc (Biorad; 5211-8004; 1:2000) and rabbit anti-Vinculin (EPR8185 ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bio-Plex Pro Human Cytokine ICAM-1 (BioRad, USA; 171B6009M) and Bio-Plex Pro Human Cytokine VCAM-1 (BioRad ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-tagged recombinant protein was purified using Ni-NTA purification with the help of Ni-charged resins (Bio-Rad). Purified protein was further used for kinase assay ...
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV and CHIKV gRNA copies with i-Taq one step universal sybr kit (BioRad) with primers detailed in Supplementary Table 5 ...
-
bioRxiv - Microbiology 2022Quote: ... neoformans cultures was determined from OD600 values measured on the I-Mark microplate reader (BioRad). Plasmodium falciparum dose-response curves were generated using SYBR Green I ...
-
bioRxiv - Microbiology 2023Quote: ... then 2 µg were used to synthesize cDNA with the i-script kit (Bio-Rad). For standard range of clbB and cysG housekeeping gene (55) ...
-
bioRxiv - Genetics 2020Quote: ... LSK were plated at day 8 of culture and monitored for growth by counting live cells by Trypan blue exclusion using a TC20TM Automated Cell Couter (BIORAD) at the indicated time ...