Labshake search
Citations for Bio-Rad :
201 - 250 of 3233 citations for Recombinant Human High Mobility Group Box 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Biophysics 2021Quote: ... and purified with a 120 mL Macro-Prep High Q column(BioRad) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the high-resolution setting on a ChemiDoc MP system (Bio-Rad).
-
bioRxiv - Plant Biology 2022Quote: ... using the iProof High-Fidelity PCR Kit (Bio-Rad Laboratories, Oslo, Norway). The following cycling protocol was used for all three genes ...
-
bioRxiv - Biophysics 2019Quote: ... through an ENrich™ SEC 650 10 × 300 High-Resolution column (Biorad) thoroughly pre-equilibrated with buffer B at room temperature ...
-
bioRxiv - Bioengineering 2019Quote: ... loaded onto a 5 mL Bio-Rad High S column (Bio-Rad), washed with 40 mL of Buffer A-cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... cDNA was generated using High-capacity cDNA Reverse Transcription Kit (Bio-Rad). qPCR analysis was performed using TB Green Premix Ex Taq reagent (TaKaRa ...
-
bioRxiv - Pathology 2020Quote: ... HbA1c was measured by high-performance liquid chromatography (Bio-Rad, Muenchen, Germany) and a Jokoh HS-10 autoanalyzer.
-
bioRxiv - Molecular Biology 2021Quote: ... on the High MW setting of a TransBlot Turbo machine (Bio-Rad). The membrane was blocked in Intercept Blocking Buffer (LI-COR Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... using iProof™ High-Fidelity DNA Polymerase (Bio-Rad; Hercules, CA, USA) (protocol available upon request) ...
-
bioRxiv - Molecular Biology 2023Quote: ... iProof High-Fidelity DNA Polymerase (500 U; Bio-Rad, Hercules, CA, USA) was used for the amplification ...
-
bioRxiv - Cell Biology 2022Quote: ... in PBS and incubated overnight at 4°C in primary antibodies: anti-human actin-β primary monoclonal antibody produced in mouse (1:100; Bio-Rad Laboratories Inc. MCA57766A) and non-muscle myosin II produced in rabbit (1:100 ...
-
bioRxiv - Bioengineering 2019Quote: ... Lysate samples were analysed for recombinant protein expression by SDS PAGE (12% Mini-PROTEAN-TGX stain-free gel; Bio-Rad), using Precision Plus unstained protein ladder (Bio-Rad ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were analysed by Western Blot using custom-made SLR1 specific polyclonal antibody with Mini-Protean II system (Biorad).
-
bioRxiv - Immunology 2021Quote: ... Recombinant Bovine Interleukin-8 PBP039 and Goat anti Bovine Interleukin-8 Ab conjugated to biotin AHP2817B (all from Bio-Rad, protocol according to the manufacturer’s intructions).
-
bioRxiv - Biophysics 2023Quote: The monovalent streptavidin sample was kindly provided by the Howarth Lab (University of Oxford),23 and recombinant IgE Kappa (clone AbD18705_IgE, Cat#HCA190) was purchased from Bio-Rad Laboratories.
-
bioRxiv - Cell Biology 2024Quote: ... the soluble fraction containing recombinant MBP-RON11-His6 protein was affinity purified twice on immobilized-metal affinity chromatography (IMAC) column using FPLC (Biorad) and further purified on CHT Ceramic Hydroxyapatite column ...
-
bioRxiv - Immunology 2024Quote: 96-well flat-bottom NUNC Maxisorp plates were coated overnight at 4 °C with 0.5 mg/mL recombinant HBsAg (BIO-RAD). Plates were washed with PBS/T ...
-
bioRxiv - Microbiology 2022Quote: ... from 22 people were quantified using a Bio-Plex Pro™ Human Inflammation 24-Plex Panel or a Bio-Plex Pro™ Human Th17 Cytokine Panel 15-Plex Panel (Bio-Rad, Hercules, CA, USA). Cytokines were omitted from further analyses if their concentration was close to the lower limit of detection in most samples ...
-
bioRxiv - Biochemistry 2021Quote: ... Human primers were designed by using Beacon Designer software (Bio-Rad). Quantitative PCR was performed on a CFX96 real-time PCR thermocycler (Bio-Rad ...
-
bioRxiv - Immunology 2019Quote: The following antibodies were used: anti-human CD53 (MEM-53, Biorad), anti-human CD53-488 (MEM-53 ...
-
bioRxiv - Immunology 2020Quote: Human CTL were transfected using a GenePulser Xcell electroporation system (BioRad). 1x106 CTL (5days after restimulation therefore in expansion phase ...
-
bioRxiv - Pathology 2023Quote: ... or mouse monoclonal antibodies against human C3d (Bio-Rad Laboratories, CA) and C4d (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primers/probes to detect human RPP30 (BioRad Custom Assay, Hercules, CA) were used as an endogenous reference in human samples ...
-
bioRxiv - Biochemistry 2022Quote: ... The soluble recombinant protein within the supernatant was purified and dialysed using the Profinia Affinity Chromatography Protein Purification System (Bio-Rad), with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: SDS-PAGE analysis of the recombinant TMPT2A (rTMPT2A) was performed on linear 12.5% polyacrylamide minigels in a Mini-Protean® Tetra cell system (BioRad, USA), as described by [22] ...
-
bioRxiv - Plant Biology 2022Quote: ... The purity of the recombinant protein was evaluated by SDS-PAGE and Coomassie staining (ChemiDoc Imaging System; BioRad, Hercules, CA, USA), and the concentration of the purified recombinant protein was determined with a Bio-Rad protein assay kit using bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2022Quote: ... Blocking buffer was removed and 100 µL/well of samples and IFN-γ standards (recombinant bovine IFN-γ; Bio-Rad Antibodies) starting at 300 ng/mL followed by two-fold dilutions added ...
-
bioRxiv - Genetics 2023Quote: ... The rabbit polyclonal antiserum was raised against purified recombinant Thp1 protein and subsequently affinity purified as Thp1p coated affinity beads (Affi-Gel 10 beads, Bio-Rad) according to standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... and the fractions containing the recombinant vaccine candidates were automatically collected using BioFrac™ Fraction Collector (Bio-Rad Laboratories, Hercules, USA) when the 280 nm absorbance was greater than 0.05 ...
-
bioRxiv - Immunology 2021Quote: ... The manufacturer’s protocol for iProofTM High-Fidelity DNA Polymerase (Bio-Rad Laboratories, Inc.) was followed using iProof HF buffer supplemented with 3% DMSO ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA sequences were amplified by PCR reactions using iProof High Fidelity polymerase (BioRad). Primers used for cloning are listed in Suppl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The automated clustering algorithm of the High Precision Melt software™ (Bio-Rad Laboratories ...
-
Cellular and structural basis of synthesis of the unique intermediate dehydro-F420-0 in mycobacteriabioRxiv - Biochemistry 2020Quote: ... The clarified supernatant was applied to a High Q Anion Exchange Column (Biorad) equilibrated in 50 mM Tris (pH 7.5) ...
-
bioRxiv - Microbiology 2020Quote: ... followed by anion-exchange chromatography (Bio-Scale Mini Macro-Prep High Q; BioRad). Fractions containing the recombinant proteins were pooled and injected into a size-exclusion chromatography column (Superose12 10/300 GL ...
-
bioRxiv - Plant Biology 2022Quote: ... DNA sequences were amplified by PCR reactions using iProof High Fidelity polymerase (BioRad). Primers used for cloning are listed in Supplementary File 1b ...
-
bioRxiv - Plant Biology 2021Quote: ... The CaFT1 sequence was amplified by iProof High-Fidelity DNA Polymerase (Bio-Rad) with restriction enzyme site tag insertion (Fw-EcoRI and Rv-BamHI) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plants were genotyped by high resolution melting using the precision melt supermix (Biorad) in a Roche Lightcyler 480 and further confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was loaded onto a Macro-Prep High Q column (Bio-Rad) pre-equilibrated with Arp buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... using the high molecular weight option on a Biorad Turbo transfer machine (Biorad) using the high molecular weight option ...
-
bioRxiv - Microbiology 2021Quote: ... All PCR steps were performed with iProof High-Fidelity DNA polymerase (Bio-Rad) and cloning products were electroporated into MegaXDH10B T1R electrocompetent cells ...