Labshake search
Citations for Bio-Rad :
651 - 700 of 3204 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Whole muscle bulk gene expression was measured by RT-qPCR on a CFX96 Real-Time PCR Detection System (Bio-Rad, 1855195) in 20 μL reactions of iTaq™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... 250 ng of RNA was used as a template in each reaction with iTaq Universal One-Step RT-qPCR Kit (Bio-Rad) or Luna Universal One-Step RT-qPCR Kit (New England Biolabs) ...
-
bioRxiv - Immunology 2020Quote: Reverse transcription: 200 ng of RNA was reverse transcribed using iScript Advanced cDNA Synthesis kit for RT-qPCR (1702537, Bio-Rad) according to the manufacturer’s specifications ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was carried out in 96-well optical reaction plates using the iQ™ SYBR® Green Supermix (Bio-Rad). The reference gene Actin and gene-specific primers for the RT-qPCR are listed in Supplementary Table S8.
-
bioRxiv - Cell Biology 2021Quote: ... Real-time quantitative reverse-transcription polymerase chain reaction (RT-qPCR) was performed using the iTaq Univer SYBR Green 1-Step Kit (Bio-Rad) on a StepOnePlus Real-time PCR system (Applied BioSystems ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCR was performed with SYBR Green PCR mix on the Bio-Rad CFX Connect Real-Time PCR System (Bio-Rad). The reaction protocol used was 95 °C for 30 s ...
-
bioRxiv - Developmental Biology 2021Quote: ... Quantitative real-time RT-PCR (qPCR) was performed using the Bio-Rad CFX384 thermal cycler and the iTaq Universal SYBR Green Supermix (Bio-Rad). All samples were processed in triplicate and analyzed as described previously (Livak and Schmittgen ...
-
bioRxiv - Microbiology 2020Quote: ... The concentration of total 16S rRNA gene copies per sample was also estimated using qPCR with the CFX96 RT-PCR machine (Bio-Rad). The concentration of the components in the qPCR mix used in this study were as follows ...
-
bioRxiv - Microbiology 2021Quote: One step RT-qPCR was conducted to detect the viral RNA load in each sample using Reliance One-Step Multiplex Supermix (BioRad, USA) containing the Reliance Reverse Transcriptase enzyme ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed in duplicate for each gene using the CFX Connect™ Real-Time PCR Detection System (Bio-rad) and SYBRGreen PCR Master Mix (Eurogenetec) ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was subject to RT-qPCR for genes of interest in duplicate using a CFX96 real-time PCR system (Bio-Rad) at 95 °C for 3 min ...
-
bioRxiv - Bioengineering 2022Quote: ... RT–qPCR was performed with technical triplicates for each experimental replicate using SsoAdvanced Universal SYBR® Green Supermix (Bio-Rad #1725270) with primer pairs shown in Supplementary Table 2 ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR analysis was performed for the gene PR1 (AT2G14610) with iQ SYBR Green supermix (Bio-Rad Laboratories, Hercules, CA, USA) and the CFX Connect Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Zoology 2022Quote: ... sfRNA and 3’UTR were quantified together by RT-qPCR using the iTaq Universal Sybr green one-step kit (Bio-Rad) with primers previously designed [26] ...
-
bioRxiv - Neuroscience 2022Quote: ... First-strand cDNA synthesis was performed from 1 μg of RNA using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). Primers were designed using the NCBI Primer-BLAST tool and supplied by Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... The resulting cDNA was diluted 1:50 in water and subjected to RT-qPCR using the CFX384 Touch Real-Time PCR Detection System (BIO-RAD) and the ORA-qPCR Green ROX L 2X Mix (HighQu ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1μg of RNA per sample were used for reverse transcription using iScript™ Reverse Transcription Supermix for RT-qPCR (Biorad, 1708841) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The RT-qPCR was performed with 2x RealStar Green Fast Mixture (Genstar) on Multicolor Real-Time PCR Detection System (Bio-Rad). Reaction parameters for thermal cycling were 95°C for 2 min ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA served as a template for subsequent reverse transcription into cDNA by iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). Specific primers (cDNA_CDIN1_Fw ATGATACTGACCAAAGCTCAGTAC and cDNA_CDIN1_Rv TCAAGCTATGCTGTGGCATAA ...
-
bioRxiv - Cell Biology 2023Quote: ... Changes in mRNA levels of the target genes were determined by relative RT-qPCR with a CFX96TM Real‒Time PCR Detection System (Bio-Rad) using iQ TM SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... targeting SARS-CoV-2 gRNA and N protein sgRNA were used for the quantification by RT-qPCR using iTaq Universal SYBER Green Supermix (Bio-Rad) and normalised to β-actin using 2-ΔΔCT.
-
bioRxiv - Microbiology 2023Quote: The bacterial and fungal loads in extracted DNA samples were quantified by RT-qPCR using the iTaq Universal SYBR Green One-Step kit (Bio-Rad). Each reaction was prepared in a final volume of 20 µL containing 5 µL of template DNA ...
-
bioRxiv - Plant Biology 2023Quote: RT-qPCR was performed in 96-well plates using the CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA). Six biological replicates were used from each treatment and each qPCR run used three technical replicates of each sample (i.e. ...
-
bioRxiv - Microbiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from DNase-treated RNA using iScript Reverse Transcription Supermix for RT-qPCR (BIO-RAD catalog: 1708841). 100ng of RNA template in a 10μl volume reaction was used with 2μl of iScript RT Supermix ...
-
bioRxiv - Microbiology 2023Quote: ... Complementary DNA (cDNA) was synthesized from DNase-treated RNA using iScript Reverse Transcription Supermix for RT-qPCR (BIO-RAD catalog: 1708841). 20μl volume reaction was used with 4ul of iScript RT Supermix and 200ng RNA template input ...
-
bioRxiv - Cell Biology 2023Quote: ... and equal amounts of sample RNA were used to synthesize cDNA using the iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). Per reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA was generated by reverse transcription of up to 9 ng RNA from each sample using iScript Reverse Transcription Supermix for RT-qPCR (BioRad, 1708841). mRNA expression was determined on a StepOnePlusTM Real-Time PCR System (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... The expression of TRAF6 was determined relative to GAPDH using iTaq Universal SYBR Green One step RT-qPCR kit (Bio-Rad) employing the Ct method as described in Bio-Rad RT-qPCR user manual.
-
bioRxiv - Cancer Biology 2024Quote: ... Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) assays were conducted on the CFX96 real-time detection system (Bio-Rad, USA) with the SYBR Green PCR Mix (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... and pdhB (PdhB-F and PdhB-R) were then used in RT-qPCR using the cDNA samples as template using iQTM supermix (Bio-Rad) in a two-step PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... Target sites identified from ChIP sequencing analysis were further validated by ChIP-qPCR using the Biorad SYBR Green Master Mix (Biorad). Primers details for the ChIP-qPCR are provided in S5 Table ...
-
bioRxiv - Plant Biology 2019Quote: ... 2% of samples were used as templates to perform quantitative PCR (qPCR) using SYBR Green PCR Master Mix (Bio-Rad) with primers recognizing the Ds element or an unrelated intergenic region in soybean chromosome 7 ...
-
bioRxiv - Neuroscience 2020Quote: ... Real-time PCR was performed using iTaq qPCR master mix according to manufacturer’s instructions (Bio-Rad, Segrate, Italy, Cat. 1725124) on a SFX96 Real-time system (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Each qPCR assay was performed in 50 μl with PCR master mix (iQ™ Multiplex Powermix, Bio-Rad Life Science), 250 nM primers and 100 nM probe ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative PCR (qPCR) was done with cDNA equivalent to approximately 100ng of RNA using the Sso Fast 2x master mix (BioRad) in a Bio-Rad CFX384 machine ...
-
bioRxiv - Cell Biology 2022Quote: ... The reaction for the multiplex real time PCRs contained 1× SYBR Green qPCR Master Mix (Bio-Rad, Hercules, CA, USA), 10 ng of each template ...
-
bioRxiv - Molecular Biology 2020Quote: ... QRT-PCR was performed with Hieff® qPCR SYBR Green Master Mix (Yeasen, China) using CFX96 system (Bio-Rad, USA). The qRT-PCR primer sequences were available in Table 1 ...
-
bioRxiv - Pathology 2020Quote: ... The reaction for the multiplex real time PCRs contained 1× SYBR Green qPCR Master Mix (Bio-Rad, Hercules, CA, USA), 10 ng of each template ...
-
bioRxiv - Plant Biology 2022Quote: ... The qPCR was carried out using ChamQ Universal SYBR qPCR Master Mix (Vazyme) in the CFX96 Connect Real-time PCR Detection system (BioRad). Actin2 was used as the internal control and the sequences of the primers used for RT-qPCR is provided in Supplementary Table 1.
-
bioRxiv - Physiology 2023Quote: ... 500 ng RNA was reverse transcribed using HiScript III 1st Strand cDNA Synthesis Kit followed by qPCR reactions using SYBR Green master mix and analyzed by Biorad CFX Touch Real-Time PCR Detection System (SIA-PCR008) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20 μL of ddPCR mixes were used to generate droplets in a QX200 Droplet Generator (Bio-Rad), following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... qRT-PCR reactions were prepared with SYBR Green RT-PCR Master mix (Thermo; S9194) and run with a CFX Connect Real-Time System (Bio-Rad). Samples were run in triplicate ...
-
bioRxiv - Neuroscience 2022Quote: ... 5ng of cDNA was loaded per qRT-PCR reaction using fast SYBR master mix and reactions run on a CFX96 RT-PCR detection system (Bio-Rad). The following primers were used:
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μL of each sample was used for quantitative RT-PCR with 2x SYBR green Master Mix and the CFX96 Touch Real-Time PCR Detection System (Bio-Rad). Samples were run in triplicate ...
-
bioRxiv - Plant Biology 2020Quote: Forward and reverse new PCR primers for the 12 Zn transport-related genes and the two reference genes suitable for SYBR® Green II RT-qPCR assays (Biorad, USA) were designed (Table 2) ...
-
bioRxiv - Genomics 2019Quote: ... Random hexamers were used for cDNA synthesis and RT-qPCR was then carried out in triplicate using Bio-Rad iTaq Universal SYBR Green Supermix (Bio-Rad 1725120). All RT-qPCR primers are provided in Table S3.
-
bioRxiv - Neuroscience 2021Quote: ... Selected genes were validated with reverse transcription and real-time PCR (RT-qPCR) with SYBR Premix on Bio-Rad CFX 96 (Bio-Rad Inc.), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Quantitative cDNA detection was performed via quantitative real-time PCR (RT-qPCR) with the same gene-specific primers using the iQ™ SYBR® Green Supermix Kit (BIORAD). Serially diluted genomic DNA was used as a quantification standard.
-
bioRxiv - Plant Biology 2020Quote: ... Q-PCR was performed on a Bio-Rad IQ5 real-time PCR detection system by using iTaq Universal SYBR Green One-Step RT-qPCR kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Real-Time quantitative Polymerase Chain Reaction (RT-qPCR) was performed using a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) using 3 ng of cDNA per reaction and Sensifast SYBR No-ROX mix (Bioline Corporation ...