Labshake search
Citations for Bio-Rad :
351 - 400 of 7095 citations for DNA Damage 8 OHdG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and transferred into a 96-well PCR plate (heat-sealed with a foil plate seal, Bio-Rad). PCR was carried out in a C1000 thermal cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... thin walled plates 384-well PCR Plate (ABgene 12164142) by using SYBR Green Supermix (Biorad, 172-5124), 10% (v/v ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The plates were washed using a 96-well plate magnetic handheld washer from Bio-Rad (NSW, Australia). The Bio-Plex Manager 3.0 software was used to operate the system and interpret the data.
-
bioRxiv - Cancer Biology 2021Quote: ... Messenger RNA (mRNA) was converted to a single-stranded complementary DNA (cDNA) using iScript cDNA Synthesis Kit (Bio-Rad). Q-PCR was performed using Lightcycler 480 SYBR Green 1 Master Kit (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Messenger RNA (mRNA) was converted to a single-stranded complementary DNA (cDNA) using iScript cDNA Synthesis Kit (Bio-Rad). qPCR was performed using Lightcycler 480 SYBR Green 1 Master Kit (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: ... Synthesis of complementary DNA (cDNA) was completed using 1 μg of RNA and the iScript cDNA synthesis kit (BioRad). Each qRT-PCR was performed as triplicate reactions with the following reaction mixture ...
-
bioRxiv - Molecular Biology 2020Quote: ... Complementary DNA was synthesized from 1 μg total RNA with an iScript cDNA Synthesis Kit (Bio-Rad, Munich, Germany). A CFX 96 Connect™ system (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... RNA templates were then utilized for complimentary DNA (cDNA) synthesis utilizing the iScript cDNA synthesis kit protocol (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... Complementary DNA was then synthesized from 1 μg of total RNA using iScript cDNA Synthesis Kit (1708890, Bio-Rad) and Bio-Rad T100 thermocycler ...
-
bioRxiv - Immunology 2023Quote: ... Freshly isolated mRNA was reverse transcribed into complementary DNA with random primers by iScript cDNA Synthesis Kit (Bio-Rad).
-
bioRxiv - Neuroscience 2024Quote: ... cDNA was synthesized using candidate primers (Integrated DNA Technologies; Table 1) and an iScript cDNA Synthesis Kit (Bio-Rad). Relative mRNA expression was analyzed by quantitative RT-PCR using the QuantStudio PCR System (Applied Biosystems ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... triplicates of each sample were run per plate (Hard-shell PCR Plates 96 well, thin wall; Bio-Rad), which were sealed with Microseal ‘B’ Seals (BioRad) ...
-
bioRxiv - Developmental Biology 2021Quote: Proteins from each sample were resolved using a precast 8-16% gradient gel (Biorad), and transferred to a PVDF membrane following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Products were detected by running an 8% acrylamide gel (19:1 acrylamide:bisacrylamide) (Bio-Rad), 1X TBE ...
-
bioRxiv - Genomics 2020Quote: Lysates were separated by SDS-PAGE on 3-8% Tris-acetate gels (BioRad #3450129) for 2.5 hours at 150V ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and cryostat sections (8 mm) were stained using rabbit anti-FITC (BioRad; 4510-780) and rat anti-CD31 (BD Biosciences ...
-
bioRxiv - Biochemistry 2022Quote: ... The SDS-PAGE gel used weas a pre-cast 8-16 % gradient (Bio-Rad) and initially stained using Pro-Q™ Emerald 300 glycoprotein staining kit to highlight glycoproteins and subsequently stained with coomassie to visualise total protein ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on 8–16% Mini-PROTEAN® TGX Precast gels (Bio-Rad) and transferred onto 0.2 µm nitrocellulose membrane (Bio-Rad) ...
-
bioRxiv - Genetics 2022Quote: ... and equal amounts were separated by 4–15% or 8–16% SDS-PAGE (BioRad) and blotted onto polyvinylidene fluoride (PVDF ...
-
bioRxiv - Immunology 2020Quote: ... pH 8) and eluted by boiling the samples for Laemmli sample buffer (Bio-Rad). Eluates were collected from the beads by centrifugation and resolved on a NUPAGE 4-12 % Bis-Tris gel (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... 25ug of sample was loaded per well on 8-12% Bis-Tris gels (BioRad) and run for 2.5h/100V ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were separated on gradient 8-16% Mini-Protean TGX precast gels (Bio-Rad) and transferred onto 0.45 μm pore nitrocellulose ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clarified whole cell lysates were run on a 8-16% SDS-PAGE gel (BioRad) and transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... samples were run through Criterion XT Tris-acetate precast gels (3-8% gradient) (Biorad) in a XT tricine buffer (Biorad) ...
-
bioRxiv - Immunology 2023Quote: ... The lysates were separated by 8-16% pre-cast SDS-PAGE gels (Bio-Rad) and transferred onto PVDF membranes ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein was separated by 8%–12% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (Bio-Rad) and blotted on polyvinylidene difluoride membrane (Merck Millipore) ...
-
bioRxiv - Cell Biology 2022Quote: ... Up to 5 μg of total RNA was reverse transcribed into cDNA using iScriptTM Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad). Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysates were sonicated with a microtip for 5 sec at 20% amplitude and quantitated in DC Protein Assay kit II (BioRad, 5000112) against a BSA standard curve ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Cell Biology 2019Quote: ... Bio-Dot SF Microfiltration Apparatus plates (BioRad) were used to transfer the protein samples onto the nitrocellulose membranes ...
-
bioRxiv - Neuroscience 2021Quote: ... in 96 well PCR plates (Bio-Rad) on a CFX96 Touch Real Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Neuroscience 2020Quote: ... in 96-well reaction plates (Bio-Rad). For pS6- and Sst-TRAP experiments ...
-
bioRxiv - Microbiology 2020Quote: ... Plates were imaged using a ChemiDoc (Biorad).
-
bioRxiv - Immunology 2023Quote: ... plates were placed in a thermocycler (BioRAD), where it is heated to 65 °C for 2min and cooled to 10 °C for 5min ...
-
bioRxiv - Plant Biology 2023Quote: In a 96-well qPCR plate (Biorad), 5 µL of 10 µM total protein of sfGFP1-10 Ni-NTA eluate in storage buffer (10mM Tris ...
-
bioRxiv - Immunology 2023Quote: ... Plates were placed in a thermocycler (BioRAD) with the following program ...
-
bioRxiv - Neuroscience 2023Quote: ... sealed with PX1 PCR plate sealer (BioRad) and cycled in a T100 Thermal Cycler (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... In a qPCR plate (Bio-Rad MLL9601), 1 µL of cDNA was dispensed ...
-
bioRxiv - Plant Biology 2023Quote: ... with hard-shell-96 well plates (BIORAD). Each reaction was carried out with 4 μL master mix (Titan HotTaq EvaGreen ...
-
bioRxiv - Immunology 2024Quote: ... with 96-well plates (Bio-Rad Laboratories), Microseal ‘B’ plate sealers (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA (1µg) was reverse transcribed into complementary DNA using an iScript Reverse Transcription Supermix kit (Bio-Rad, Hercules, CA, USA). The relative levels of gene transcripts compared with the control gene 18S were determined by quantitative real-time PCR using SYBR Green PCR Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... The RNA was then cleared of genomic DNA using DNAse from an iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad).
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA (cDNA) was synthesized from 500 ng of purified RNA using the iScript™ cDNA Synthesis Kit (Bio-Rad) following protocols provided by the manufacturer.