Labshake search
Citations for Bio-Rad :
151 - 200 of 5423 citations for Cow NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2019Quote: ... Collected sera were subjected to ELISA by capturing with human anti-rituximab idiotype antibody (HCA186, Bio-Rad Laboratories), detected with rat-anti-rituximab-HRP antibody (MCA2260P ...
-
bioRxiv - Microbiology 2019Quote: ... and plates were read 3 times at 450 nm in the model microplate ELISA reader (BIO-RAD, Japan). Negative controls (coated with naive sera ...
-
bioRxiv - Microbiology 2021Quote: ... All serum samples were confirmed as Dengue virus-positive by means of NS1 diagnostic ELISA test (Platelia, Biorad). Serum samples were filtered using Millipore 0.22 μm PES syringe filters ...
-
bioRxiv - Immunology 2021Quote: ... the OD values were read at 450/620 nm by an ELISA plate reader (Bio-Rad, Hercules, CA).
-
bioRxiv - Immunology 2020Quote: ... Gene expression was determined by quantitative reverse transcription polymerase chain reaction (qRT-PCR) using SYBR Green PCR Master Mix (Bio-Rad Laboratories Inc., Hercules, CA, USA) using the gene-specific primers (Table 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked in 5% BSA or 5% milk dissolved in TBS (Biorad) containing 0.1% Tween 20 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and finally TMB (3,3’, 5, 5’-tetramethylbenzidine) Core+ reagent (Bio-Rad cat # BUF062C) for development ...
-
bioRxiv - Cell Biology 2022Quote: ... Up to 5 μg of total RNA was reverse transcribed into cDNA using iScriptTM Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad). Quantitative real time-PCR was performed using GoTaq® qPCR Master Mix (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... anti-CD63 and anti-CD81 detection antibodies (supplied in the MACSPlex kit, 5 µl each) or anti-decoy receptor antibodies (AlexaFluor647-labelled anti-human TNFR1, Bio-Rad, cat #MCA1340A647 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Lysates were sonicated with a microtip for 5 sec at 20% amplitude and quantitated in DC Protein Assay kit II (BioRad, 5000112) against a BSA standard curve ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription (RT) was performed from 2 to 5 µg of RNA with iScript Adv cDNA synthesis kit (Bio-Rad #1725038). The cDNA was diluted 5 times and 1 μL of this was used for each reaction in real-time PCR ...
-
bioRxiv - Immunology 2020Quote: ... IL-23 was measured using either a mouse IL-23 ELISA (R&D) or Luminex based method from BioRad. IL-12p40 ...
-
bioRxiv - Immunology 2020Quote: ... followed by measuring the absorbance of individual wells at 450 nm using an ELISA reader (Bio-rad mod.550). Serum samples from unmanipualted mice were used for negative controls.
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 µL of SybrGreen (BioRad) and 2.5 µL of primer-mix (800 nM ...
-
bioRxiv - Microbiology 2019Quote: ... 5 µl HF buffer (BioRad), 5 µl combinational enhancer solution (2.7 M betaine ...
-
bioRxiv - Cell Biology 2021Quote: ... 25 ng of cDNA template was mixed with the primers to final concentrations of 200 nM and mixed with 5 μl of iTaqTM Universal SYBR® Green Supermix kit (Bio-Rad). The reactions were done in triplicates with the following conditions ...
-
bioRxiv - Immunology 2022Quote: ... Oligo-dT first strand cDNA synthesis was performed from 5 μg total RNA with iScript Advance cDNA Synthesis Kit for RT-qPCR (Bio-Rad; #1725038) following manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... The blot was then washed in 6x 5 minutes of TBST prior to being developed with Clarity™ Western ECL Substrate kit (Bio-Rad). To examine actin levels as a loading control blot was stripped using Restore™ WesternBlot Stripping Buffer (Thermo Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Serum was collected at day 49 and anti-M1 titers were measured by ELISA as previously described72 with a goat anti-mouse HRP-conjugated secondary antibody at 1:5000 (BioRad). Immunized and control mice were infected subcutaneously into the flank with 2×107 cfu of the AP1 (n=17 ...
-
bioRxiv - Neuroscience 2024Quote: ... and the absorbance value of each well was measured at a wavelength of 450 nm on microplate ELISA reader (Microplate Manager v5.2.1 software, Bio-Rad Laboratories).
-
bioRxiv - Developmental Biology 2021Quote: ... Real-Time reactions were performed in triplicates using KAPA SYBR FAST qPCR Kit (2X) on QuantStudio 5 Real-time PCR system (Bio-Rad, CA, USA) following the manufacturer’s recommendation ...
-
bioRxiv - Developmental Biology 2022Quote: ... and up to 5 μg of total RNA was reverse transcribed into cDNA using iScriptTM Advanced cDNA Synthesis Kit for RT-qPCR (Bio-Rad, 172-5038). Quantitative real time-PCR was performed using Go-Taq qPCR Master Mix (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... and 5 U/mL aprotinin) and the protein concentrations in the lysates were determined using a BioRad protein assay kit (BioRad Laboratories, Hercules, CA). Protein samples were subjected to SDS-PAGE ...
-
bioRxiv - Biophysics 2019Quote: ... containing 5% 2-mercaptoethanol (Bio-Rad), electrophoresed by SDS-PAGE and blotted onto nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Immunology 2021Quote: ... TMB substrate was added to stop the reaction before performing the reading at 450 nm in the ELISA plate reader (iMark Microplate Reader, Bio-Rad).
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Zoology 2021Quote: The quantitative determination of IFN-ɣ in buffalo serum was assayed by a commercial bovine IFN gamma sandwich ELISA test (Bio-Rad) following the manufacture’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... RBD-specific antibody titres in oral and nasal swab fluids were determined by ELISA as detailed above except that the conjugated secondary antibody was replaced with either goat anti-porcine IgG HRP (Bio-Rad Antibodies) at 1:20,000 dilution in PBS with 1% (w/v ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... the membrane blots were blocked in 5% blocking buffer (5% non-fat dry milk, Bio-Rad, in TBST) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad) for 1 hour at room temp ...
-
bioRxiv - Molecular Biology 2019Quote: ... which was blocked with 5% milk (BioRad, Hercules ...
-
bioRxiv - Physiology 2019Quote: ... and an iQTM 5 System (Bio-Rad) were used ...
-
bioRxiv - Cell Biology 2019Quote: ... Membranes were blocked in 5% milk (BioRad) and incubated with antibodies for BMAL-1 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... Blocking solution contained 5% milk powder (BioRad) in Tris-buffered saline containing 0.2% Tween 20 ...
-
bioRxiv - Microbiology 2021Quote: ... resolved by 5% TBE gel (Bio-Rad), and visualized using an Odyssey infrared imager (LI-COR Biosciences).
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 5% β-Mercaptoethanol (BioRad 1610710) and heated for 10 min at 100°C ...
-
bioRxiv - Microbiology 2020Quote: ... and 5% non-fat milk (Bio-Rad)) for 1 hour at room temp ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked in 5% Milk (BioRad) in 1XTBS-T and incubated overnight in primary antibodies diluted in 5% milk at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... blocked with 5% blocking protein (Bio-Rad) for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 5 second interval (Bio-Rad Gene Pulser Xcell Electroporation Systems) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 5% β-mercaptoethanol (Bio-Rad Laboratories) and boiling sample for 7 minutes followed by western blot analysis.
-
bioRxiv - Immunology 2020Quote: ... 5-μg/mL of sheep IgG (Biorad) and purified TNP (BD Pharmingen) ...