Labshake search
Citations for Bio-Rad :
401 - 450 of 3775 citations for 8 DECYLOXYPYRENE 1 3 6 TRISULFONIC ACID TRISODIUM SALT since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... samples were buffer exchanged into 150 mM of ammonium acetate pH 8 using Bio-Spin P6 columns (BioRad) and the final protein concentrations were adjust to 1-5 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini- Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... 8 ng of granuloma protein was loaded per lane into Any kD Mini-PROTEAN TGX gels (Bio-Rad), separated by SDS-PAGE and transferred to 0.2 μm nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... serum insulin was performed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (Bio-Rad, Hercules, CA) as per the manufacturer’s protocol.
-
bioRxiv - Physiology 2022Quote: ... The 8% equivalent of each fraction by volume was run on a 4-15% TGX gel (Bio-Rad) for Western blotting using affinity-purified polyclonal rabbit anti-mouse Prdm13 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 μl from each sample were loaded onto Mini Protean TGX Pre-cast 4-15% gels (Bio-Rad) and migration was carried out for approximately 45 min at 150V ...
-
bioRxiv - Microbiology 2023Quote: gp120 or SOSIP glycoproteins were separated on 8–16% SDS-PAGE (mini-PROTEAN TGX protein gels; Bio-Rad) and transferred to a 0.45 μm nitrocellulose membrane (catalog number 1620115 ...
-
bioRxiv - Genomics 2023Quote: ... the ligation products were amplified by 8 cycles of PCR on an S1000 thermocycler (Bio-Rad, Hercules, CA) using Q5 High-Fidelity PCR master mix with HF buffer (NEB Ipswich ...
-
bioRxiv - Biophysics 2024Quote: ... 20 µL of the supernatant was taken and added to 8 µL 4X Laemmli sample buffer (Bio-Rad) and 12 µL of 8M urea ...
-
bioRxiv - Cancer Biology 2020Quote: ... lysate concentrations were adjusted to equal protein concentrations using the bicinchoninic acid (BCA) protein assay (Biorad). Equal amounts of protein were mixed to a final concentration of 1x reducing sample buffer (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... boric acid) Urea solutions were made fresh daily and incubated with AG 501-X8 resin (Biorad) for minimum 5 hours to remove ionic contaminants ...
-
bioRxiv - Microbiology 2022Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, Hercules, CA, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Biochemistry 2019Quote: The acetic acid was quantified using an Aminex HPX-87H (300 x 7.8 mm, Bio-Rad) column with a Carbo-H precolumn (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleic acids (RNA or DNA) samples were loaded in Bio-Dot SF Microfiltration Apparatus (Bio-Rad) and allowed to bind onto the membrane ...
-
bioRxiv - Biophysics 2019Quote: ... Mouse anti Tubulin beta 3 antibody from BioRad (Hercules, CA, US). We used a 6xHis-GFP-labeled truncated human kinesin-1 heavy chain construct (amino acids 1-560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The membranes were blocked with 3% nonfat dry milk (BioRad 1706404) in 1X PBST for 30 min at room temperature and incubated with the GAPDH antibody (Cell Signaling Technology 2118 ...
-
bioRxiv - Microbiology 2019Quote: ... After washing the plate 3× (MAG3× setting on BioRad wash station) with wash buffer (PBS with 0.05% Tween20) ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2022Quote: ... at 400 mA for 3 hours using a MiniTransblot Module (BioRad). After protein transfer ...
-
bioRxiv - Biochemistry 2023Quote: ... pH 3-10 ReadyStrip IPG Strips (Bio-Rad, Hercules, CA, USA) at 50 μA per strip at 20 °C ...
-
bioRxiv - Microbiology 2022Quote: ... and 1’,3’-bis[1-palmitoyl-2-oleoyl-sn-glycero-3-phospho]-glycerol (16:0-18:1 Cardiolipin) were spotted using a Hamilton syringe onto a nitrocellulose membrane (Biorad trans-blot turbo RTA Midi 0.2 µm) to yield 10 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2020Quote: 10-40 µg of total protein lysate were separated by SDS-PAGE on 8% or 10% polyacrylamide minigels (BioRad) and transferred onto a nitrocellulose membrane (GE healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: Proteins were separated by SDS-PAGE using a Mini-PROTEAN TGX Gel (4-15% or 8-16%, Bio-Rad Laboratories ...
-
bioRxiv - Physiology 2019Quote: ... 8 µg of total protein was separated by electrophoresis on a precast 4-15% TGX gradient gel (Bio-Rad) and transferred to a 0.45 µm nitrocellulose membrane ...
-
bioRxiv - Microbiology 2019Quote: Samples were loaded onto SERVAGel™ TG PRiME 8-16% precast gels and transferred on PVDF membranes (Bio-RAD). Proteins were detected with primary antibodies anti-St1SctP (InvJ ...
-
bioRxiv - Microbiology 2021Quote: ... The proteins were resolved by SDS-PAGE using 8–16% Mini-PROTEAN TGX Stain-Free protein gels (Bio-Rad) and transferred onto a PVDF membrane using a semi-dry apparatus (Trans-Blot Turbo Transfer System ...
-
bioRxiv - Genomics 2019Quote: ... we first assembled the 8-strip tubes into 96-well plates for increased throughput (Bio-Rad, RC9601 and MSA5001). For FACS-collected cells we proceeded directly with the obtained 96-well or 384-well plates ...