Labshake search
Citations for Bio-Rad :
201 - 250 of 5618 citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... A one-step RT-PCR kit (BioRad) was used to detect the viral RNA using Applied Biosystems QuantStudio 12K Flex Real-Time PCR System with the following cycling protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and quantified using Quantity One (Bio-Rad).
-
bioRxiv - Plant Biology 2021Quote: ... and Quantity One® software (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... and Quantity One v4.6.9 (Bio-Rad, USA) to quantify protein and mRNA ...
-
bioRxiv - Plant Biology 2021Quote: ... and vitamin B-12 (Mr 1,350) (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... which were sealed with Microseal ‘B’ Seals (BioRad). All experiments were run on a CFX96 Touch Real-time Detection system with a C1000 Touch Thermal cycler (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2021Quote: ... which were sealed with Microseal ‘B’ Seals (BioRad). All experiments were run on a CFX96 Touch Real-time Detection system with a C1000 Touch Thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: ... Cover plate with Microseal ‘B’(Biorad, MSB-1001). Give the plate a quick spin to collect all liquid at the bottom (Sorvall or Allegra centrifuges ...
-
bioRxiv - Biochemistry 2021Quote: ... Plates were sealed with Micoseal ‘B’ seals (BioRad). Thermal melt analysis was performed in a QuantStudio 6 Flex RT-PCR device (ThermoFisher ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and covered by Microseal ‘B’ seal (Bio-Rad). qRT-PCR was run in the BIO-RAD CFX connect system ...
-
bioRxiv - Cell Biology 2024Quote: ... sealed with Microseal ‘B’ seals (Bio-Rad, MSB1001), and conducted in the CFX96 Touch Real-Time PCR Detection System (Bio-RAD ...
-
bioRxiv - Microbiology 2022Quote: ... NS5B-FAM probe: 5’-ATGGGTTCGCATGGTCCTAATGACACAC-3’) and the GAPDH loading control (PrimePCR Probe assay with HEX probe, Bio-Rad). Each 20 μL reaction contained 500 ng of total RNA ...
-
bioRxiv - Biophysics 2024Quote: ... Blots were washed 3 times with TBST for 5 min and visualized using a ChemiDoc MP Imaging System (Biorad).
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
Checkpoint adaptation in repair-deficient cells drives aneuploidy and resistance to genotoxic agentsbioRxiv - Cell Biology 2019Quote: ... Images were taken after 3 to 4 days (unless indicated otherwise) using the ChemiDoc™ Touch Imaging System (Bio-Rad). Agar plates contained the vital dye Phloxine B at a final concentration of 8 µg/mL.
-
bioRxiv - Microbiology 2020Quote: ... coated with PBS alone or with 2 µg/ml of SARS-CoV-2 S protein in PBS overnight at 4°C were blocked for 1 hour with 3% nonfat dry milk (Biorad) in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Neuroscience 2022Quote: ... equal amounts of protein (2.5 or 10 µg) were separated by SDS-PAGE on 4-12% Bis-Tris or 3-8% Tris acetate gels (Criterion XT, BioRad) and transferred to nitrocellulose using TransBlot Turbo (BioRad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Immunology 2021Quote: ... with 0.5 μl of b-mercaptoethanol per well and heated at 70°C for 10 minutes before separation on a polyacrylamide gel (Bio-Rad Mini-PROTEAN TGX Gel 4-15%) and transferred to a PVDF membrane ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Physiology 2019Quote: ... qPCR was performed using Taqman probes for β-actin (assay #Mm02619580_g1) and MMP13 (assay #Mm00439491_m1 which targets exons 4-5) and using iQ SYBR Green Supermix (BioRad) with β-actin as the housekeeping gene (primer sequences given in Supp ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Molecular Biology 2023Quote: ... heated at 95°C for 5 min then run on a 4-12% Bis-Tris gel (BioRad 3450125). The input sample is identical to the initial solution containing protein in 60 μL 1x selection buffer prior to capture with 20 passages over the ME200 tip ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Plant Biology 2022Quote: ... One-step RT-qPCR was performed using an iTaq Universal SYBR Green One-Step RT-qPCR Kit (BIO-RAD). The reaction was performed in a total volume of 20 μL by mixing 10 μL iTaq universal SYBR Green reaction ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed with TBS-T (3 × 5 minutes) and incubated in horseradish peroxidase (HRP)-conjugated secondary antibody (1:1000) (BioRad) in blocking solution for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... which is pre-equilibrated by Buffer A before use with rotation at 3 hr in 4°C in Econo-Pac Chromatography Columns (20 mL, Bio-Rad). After the unbounded fraction was discarded ...
-
bioRxiv - Immunology 2020Quote: ... Samples were heated at 95°C for 3 minutes and run on a 8 – 16% or 4 – 20% TGX-Criterion gel (Bio-Rad). The separated proteins were transferred to PVDF membranes and blocked in PBS containing 0.2% fish skin gelatin (Sigma-Aldrich ...
-
bioRxiv - Immunology 2020Quote: ... Samples were boiled for 3 min and sonicated for 30 s prior to loading on 4-20% Mini-PROTEAN TGX precast protein gels (Bio-Rad) and electrophoresis in Tris-glycine buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... A total of 3-4 μg of total RNA was reverse transcribed using the iScript advanced cDNA synthesis kit (Bio-Rad). Quantitative PCR of target genes (Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was run at 125 V for 3 to 4 hours and the RNA was then transferred to a Zeta-Probe GT membrane (Bio-Rad) by capillary action with 20 x SSC buffer (3 M NaCl ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... 10 µg of RNA was transfected into 4×10^6 S10-3 cells by electroporation with a Gene Pulser II apparatus (Bio-Rad) in 0.4 cm Gene Pulser cuvettes (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: Viral RNA was quantified via a one-step qRT-PCR using the iTaq universal probes one-step kit (Bio-Rad) per the manufacturer’s instructions for a 20µL reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... The amount of ATP for one cell was derived from the amount of protein in one cell found via Bradford assay (BioRad).
-
bioRxiv - Physiology 2021Quote: ... 9% or 12% -SDS polyacrylamide gel electrophoresis and transferred to PVDF Immobilon membranes (Biorad). After 1h-saturation in TBS/0.2% Tween/2% milk (RT) ...
-
bioRxiv - Neuroscience 2022Quote: Samples were loaded on a home-made 9 or 10% Bis-Acrylamide (Bio-Rad) gel and the gel was subsequently transferred by wet transfer to a PVDF membrane (Bio-Rad ...
-
bioRxiv - Molecular Biology 2024Quote: ... HRP signal was detected in 9:1 mix of Clarity:Clarity Max ECl reagent (BioRad) and captured using a Chemidoc Touch imager (BioRad).
-
bioRxiv - Genetics 2021Quote: ... membranes were incubated 2h in TBS-T with 2% BSA containing secondary anti-rabbit antibodies-HRP conjugate (1:2000, #1721019 Bio-Rad, Hercules, CA). After three more washes in TBS-T ...
-
bioRxiv - Microbiology 2022Quote: ... Wako Chemicals) in Tris-MOPS running buffer (Wako Chemicals guidebook) for 2h at 100V using a Mini-PROTEAN® Tetra system (Bio-Rad Laboratories). After migration ...