Labshake search
Citations for Bio-Rad :
1 - 50 of 5618 citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Molecular Biology 2019Quote: ... Either regular (Figure 4 and 5) or stain-free (Figure 8 and 9, Bio-Rad #1610182) 10 % acrylamide gels were used ...
-
bioRxiv - Cell Biology 2021Quote: ... MMP2/9 secretion was quantified using Quantity One Software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... and electro-blotted onto PVDF membranes (Biorad: 100 V, 2h, 4°C). The transferred proteins were then renatured by progressively reducing the guanidine-HCl concentration ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Developmental Biology 2023Quote: FLICA™ 660 Caspase-3/7 (BIORAD) was used to measure apoptosis according to manufacturers.
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Immunology 2021Quote: ... Ly6B.2 (clone 7/4, Bio-Rad), CD133 (clone 13A4 ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Biochemistry 2020Quote: ... pH 4–7 (Bio-Rad Laboratories, Richmond, CA) strips for rehydrated of 70μg of spleen and SI proteins extracts (24hr ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2021Quote: ... pooled and subjected to two consecutive preparative isoelectric focusing (IEF) at pH 3-10 (first separation) and pH 5-7 (second separation) using a Rotofor Cell (Bio-Rad). The individual IEF fractions were harvested ...
-
bioRxiv - Immunology 2020Quote: ... Siglec-7 (5-386, Alexa Fluor 488, Bio-Rad), TIM-3 (7D3 ...
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was washed with the washing solution twice and then reacted with 4-chloro-1-naphthol (Bio-Rad Laboratories) in the HRP color development buffer (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2019Quote: ... Cell debris was cleared by centrifugation at 21000 g for 5 min at 4°C and supernatant was mixed with one-third volume 4X Laemmli Sample Buffer (Bio-Rad). For lysozyme lysis ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Neuroscience 2022Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules ...
-
bioRxiv - Genetics 2021Quote: ... rotated at 4°C for 2h and then poured into a Econo-Column® Chromatography column (Bio-Rad, Hercules, CA). After extensive washing first with 80 mL of 20 mM Tris HCl [pH8@4°C] ...
-
bioRxiv - Microbiology 2019Quote: ... The lysate was used to bind to 200ul of IgG Sepharose beads (Amersham Biosciences) for 2h at 4°C using a disposable chromatography column (BioRad). The IgG-Sepharose column was washed with 35 ml of protein A binding buffer (10 mM Tris–HCl ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Biophysics 2020Quote: ... using a 9 × 9 mm2 frame seal (SLF0201, Biorad). The chamber was plasma-treated to improve wettability ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was isolated from 6-week-old rosette leaves and bolting flower buds of Col-0 and one of the RPF2-atp1 (RPF2-atp1-9) transformed lines (T3) with PureZol reagent (BioRad). Three independent libraries for each genotype were made from total RNA treated with 250 ng of Turbo DNase (Ambion ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Frame-Seal slide chambers (9 × 9 mm2, Biorad, Hercules, CA) were then secured to a coverslip ...
-
bioRxiv - Biophysics 2022Quote: ... Frame-seal slide chambers (9 × 9 mm, Bio-rad, USA) were affixed to the glass coverslips ...
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Denatured protein extracts were resolved using 4-9% SDS-PAGE (4–15% Mini-PROTEAN® TGX™ Precast Protein Gelscat# 4561083, Biorad) and then transferred to a nitrocellulose membrane.
-
bioRxiv - Neuroscience 2022Quote: ... anti-Ly-6B.2 (1:100, clone 7/4, BioRad, raised in rat) and anti-Nur77 (NR4A1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Biochemistry 2021Quote: ... and the sample was heated to 90°C for 5 minutes before loading of 3 pmol onto a 4-15% Mini-PROTEAN TGX Stain-Free Precast Gel (Bio-Rad), alongside PageRuler Prestained Protein Ladder (Thermo Scientific) ...
-
bioRxiv - Biophysics 2021Quote: ... Frame-seal slide chambers (9 x 9 cm2, Bio-Rad, Hercules, USA) were affixed to the glass ...
-
bioRxiv - Cancer Biology 2024Quote: ... bromophenol blue) was applied onto IPG strip (7 cm, pH 3-10, Bio-Rad, 1632000) for 24 h ...
-
bioRxiv - Immunology 2021Quote: ... clone AT152-9 (BioRad). To aggregate FcγRIIA ...
-
bioRxiv - Microbiology 2024Quote: ... 9 µm (Bio-Rad) with isocratic mobile phase 0.005 mol L−1 H2SO4 ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Neuroscience 2024Quote: ... Frame-Seal slide chambers (9 x 9 mm2, Biorad, Hercules, USA, SLF-0601) were affixed to the glass and 50 µL of poly-L-lysine (70k-150k molecular weight ...
-
bioRxiv - Microbiology 2019Quote: ... caspase-9 and caspase-3 was done using a CFX-96 real-time PCR system (BioRad, Hercules, CA, USA). The reaction mixture for each sample carried 2 µL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... The hypervariable region V3–V4 of the bacterial 16S rRNA gene was amplified using the primers 338F (5’-ACTCCTACGGGAGGCAGCAG-3’)/ 806R (5’-GGACTACHVGGGTWTCTAAT-3’) by using a T100 Thermal Cycler PCR thermocycler (BIO-RAD, USA). The PCR reaction mixture (20 µL ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were resolved on 7 cm pH 3-10 immobilized pH-gradient (IPG) strips (Bio-Rad), under mineral oil ...
-
bioRxiv - Cell Biology 2021Quote: ... Proteins were eluted using a 20:7:3 mixture of buffer: 4x Laemmli sample buffer (Biorad):10x NuPage sample reducing agent (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2h at 300 mV using an electrophoretic transfer system (BioRad). The membranes were then blocked for 1 h with 5% of skimmed milk in PBS containing 0.1% Twen-20 (PBS-T ...
-
bioRxiv - Molecular Biology 2022Quote: ... and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad) for passive rehydration overnight at 20 °C in a Protean IEF Cell equipment (BioRad) ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... SYBR Green qPCR was performed using a ViiA7 (A&B Biosystems, Waltham, MA) with iTaq Universal SYBR Green One Step Kit (BioRad, #1725151) following the manufacturer’s instructions ...