Labshake search
Citations for Bio-Rad :
401 - 450 of 6689 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Samples were separated on 8–16 % Mini-PROTEAN® TGX™ Precast gels (Bio-Rad) and transferred onto nitrocellulose membrane ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The cultures were dispensed in 100 μL aliquots into 8-well PCR strips (Bio-Rad) and incubated for 24 h in a thermal gradient using a DNA Engine Tetrad 2 Peltier Thermal Cycler (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... 20μg protein was isolated on 8-10% SDS-PAGE and transferred to nitrocellulose membrane (BioRAD). Nonspecific binding was blocked by incubation of membranes with 10% (W/V ...
-
bioRxiv - Synthetic Biology 2023Quote: ... with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™, optical, ultraclear, #TCS0803). Optimum amplification conditions were determined for each by amplifying six concentrations of a 5× dilution series of MG1655 pJK14-Tn4rev pZA31-mCherry-tnpB using two-step amplification with a thermal gradient of 55–75°C ...
-
bioRxiv - Immunology 2024Quote: ... TNF-α) were analyzed using Bio-Plex Pro Mouse Cytokine 8-plex Assay (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-CD8 (2 µg/rat dissolved in saline solution, clone OX-8, Bio-Rad #MCA48G) or anti-rat TCRαβ antibody (2 µg/rat dissolved in saline solution ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2019Quote: ... of total 16S rRNA gene copies was carried out in triplicate 10µL reactions with 200nM 891F(5’-TGGAGCATGTGGTTTAATTCGA-3’)/1003R(5’-TGCGGGACTTAACCCAACA-3’) primers using a BioRad CFX384 thermocycler with iTaqTM Universal Probes Supermix (BioRad 1725132) and probe 1002P ([Cy5]CACGAGCTGACGACARCCATGCA[BHQ3] ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Microbiology 2019Quote: ... Alternatively broken cyst walls either before or after digestion with trypsin were reconstituted in 1× reducing SDS/PAGE loading buffer and run on a 4–20% precast polyacrylamide TGX gel (Bio-Rad). Bands stained by colloidal Coomassie blue were excised and washed with 50 mM NH4HCO3/acetonitrile (ACN) ...
-
bioRxiv - Neuroscience 2021Quote: ... of each sample was loaded on an 8-16% (for TSPO, 3b-HSD, and StAR) or 4-20% (for mERα, caveolin-1, and PKA) SDS precast gels (Bio-Rad) and separated by electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were incubated with primary antibodies (Supplementary Table 1) overnight at 4°C and visualised with HRP-conjugated anti-IgG secondary antibodies and enhanced chemiluminescence substrates (Bio-Rad). The expression of PDHX or calnexin was used as a loading control.
-
bioRxiv - Biophysics 2022Quote: ... 1 mg of post-thrombin digested claudin-4 in DDM was treated with 4 mg of amphipol (1:4 w/w) for 2 hours before removing detergent via addition of 400 mg SM-2 biobeads (Bio-Rad). Excess cCpE was added to each claudin-4 sample at a molar ratio of 1:1.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Clarified lysates were incubated with 2 ml of glutathione resin and rotated for 1 h at 4°C in a 25 ml disposable drip column (Bio-Rad). Settled resin was washed with 25 column volumes (CV ...
-
bioRxiv - Bioengineering 2020Quote: Organoids fixed in 4% w/v PFA and immunostained were embedded in 1% w/v low melting agarose (Bio-Rad Laboratories) solution and placed in an Eppendorf tube ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated with primary and HRP-secondary antibodies in TBST buffer with 5% milk (RT for 1 hour or overnight at 4 °C) and revealed with an ECL solution (BIO-Rad) following manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... supplemented with DTT (0.1 M endconcentration) and then subjected to SDS-PAGE on 12% or 4–20% gradient gels (mini-PROTEAN TGX; Bio-Rad). Proteins were transferred to PVDF membranes (TransBlot® TurboTM LF PVDF ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was incubated for 1 h at 4°C with 0.5 mL Profinity IMAC resin (Bio-Rad Laboratories, Hercules, CA) in a buffer containing 20 mM MOPS-Na (pH 7.4) ...
-
bioRxiv - Biochemistry 2021Quote: ... and increasing concentrations of NONO(53-312) were prepared and incubated at 4°C for 1 hour before loaded onto a Dot Blot apparatus (Bio-rad) containing a nitrocellulose membrane (top ...
-
bioRxiv - Microbiology 2020Quote: The supernatants from the different lysis buffer extractions described above were diluted 1:4 in 4x Laemmli sample buffer (Bio-Rad) supplemented with beta-mercaptoethanol following manufacture’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 2% formaldehyde gel and separated at 125-150V at 4°C for 1-2 h and then transferred to a Zeta-Probe GT membrane (Bio-Rad) via capillary action overnight (Streit et al. ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative PCR (qPCR) was carried out using 4 μl cDNA (diluted 1:20) with iQ SYBR Green Supermix (BioRad, CA, USA) and specific primers (Biolegio ...
-
bioRxiv - Bioengineering 2023Quote: ... Equal amounts of the proteins (50 µg) were electrophoresed (125 volts, 1 h) on a 4-20% Mini protean TGX stain-free protein gel (Bio-Rad) and transferred onto nitrocellulose membranes (125 volts ...
-
bioRxiv - Physiology 2023Quote: ... Samples were run 16 h at 9 °C at 4 V with a 1–10 running ratio in TBE buffer using CHEF-DRII system (Bio-Rad). After the run ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was diluted 1:4 with water and 2ul used as template for qPCR using 250nM primers using the SsoFast EvaGreen Supermix (BioRad 1725200) on an Applied Biosystems ViiA 7 Real Time PCR System ...
-
bioRxiv - Molecular Biology 2023Quote: RT-qPCR was employed to find the levels of quantification of mucin 1 and 4 mRNA transcripts according to protocol of the Real-Time PCR system (BioRad./ USA)[39] ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Molecular Biology 2024Quote: ... 15 µL of each sucrose gradient fraction was incubated at 95 ºC with 1 % sodium dodecyl sulfate (SDS) and applied for SDS-PAGE with a 4-20 % gradient SDS-PAGE gel (Bio-rad). The proteins were transferred to a nitrocellulose membrane (Cytiva ...
-
bioRxiv - Neuroscience 2024Quote: ... via wet transfer at 30V for 1 hour at 4 °C in 10% Methanol Tris/Glycine buffer using a Criterion™ Blotter (BioRad). Blots were all blocked for 1 hour at room temperature using Intercept (TBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... and resolved by SDS-PAGE using Criterion XT Bis-Tris precast gels (4-12%; BioRad, 3450123/4/5) and XT-MES1X as running buffer (stock 10X ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were rinsed 3×10 minutes in TBST 0.1% then incubated with appropriate secondary antibody coupled to the horseradish peroxidase (Biorad, 1706515, 1706516; 1/5000) for 1 hour at room temperature under agitation ...
-
bioRxiv - Biochemistry 2020Quote: ... Total RNA (1 µg) from each sample sets (n=3) was taken for cDNA preparation using iScript™ cDNA Synthesis Kit (Bio-Rad, USA). Real-Time qPCR was performed using PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µL primer 556R (5’ CTTTACGCCCARTRAWTCCG 3’) at 10 µM and 10 µL SYBER® Green Master Mix (Bio-Rad, Veenendaal, The Netherlands). The DNA extraction estimated an average rRNA yield corresponding to 5×10^8 bacterial cells/mL.
-
bioRxiv - Molecular Biology 2020Quote: ... or 4-15% Mini Protean gels (BioRad). Proteins were transferred to nitrocellulose membrane using Turbo-blotter (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... with 4% goat (Bio-Rad Laboratories, #C07SA) or donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Bioengineering 2020Quote: ... Polyacrylamide gels (Bio-Rad, 4-16 wt%). IFNγ ELISA (DY485 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4-15% (BIO-RAD #456-1083) Mini PROTEAN® gel in Tris/Glycine/SDS (BIO-RAD #1610772) ...
-
bioRxiv - Neuroscience 2022Quote: Criterion TGX 4-15% (Bio-Rad 5671084) and Mini-Protean TGX precast gels (Bio-Rad 4561083 ...
-
bioRxiv - Molecular Biology 2021Quote: 4-20% precast SDS PAGE gels (BioRad) were used for electrophoretic separation of immuno purified samples ...
-
bioRxiv - Immunology 2021Quote: ... 4-15% gradient gels (Bio-Rad 4561086) and transferred to PVDF membranes (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: ... run on 4-20 % polyacrylamide gels (BioRad) according to manufacturer’s instructions and analyzed by adding InstantBlue (Expedeon).