Labshake search
Citations for Bio-Rad :
201 - 250 of 6689 citations for 7 Chloro 4 hydroxy 1 8 naphthyridine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... Specific primers (Supplementary Table 7) and SSO SYBR Green Supermix (Bio-Rad) were used in qPCR reactions following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... expression media samples were diluted with 2X reducing SDS sample buffer at 1:1 ratio and the mixture was loaded on a 10-well 4–20% SDS-PAGE gradient gel (BioRad). Image J software was used to quantify the signal compared to the negative control (mock transfected culture) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 8% of 2% w/v bis-acrylamide (Bio-Rad, #1610142), 0.5% of 10% ammonium persulfate (APS ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were resolved using 8% or 12% SDS-PAGE (BioRad) or 4-12% gradient NuPAGE Protein Gel (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... at 8°C in a MyCyclerTM thermal cycler (Bio-Rad). At the indicated intervals ...
-
bioRxiv - Neuroscience 2021Quote: ... 8) anti-CD68 (#MCA1957GA, Bio-Rad Laboratories, Hercules, CA, USA) and anti-Iba-1 (#019-19741 ...
-
bioRxiv - Biophysics 2020Quote: ... 8 mL of isopropanol-washed Affigel 10 resin (BioRad; # 1536099) was mixed gently in an Erlenmeyer flask for 20 h at room temperature with 48 mL of DMSO containing 24 mg of xanthine amine congener (XAC ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were resolved by SDS-PAGE (8-16%, Bio-Rad) and visualized by Coomassie staining ...
-
bioRxiv - Microbiology 2020Quote: ... and purified from remaining salts using Dowex 50 W X 8 50-100 mesh (Bio-Rad, 10 x 1 cm, H+ form) equilibrated with water ...
-
bioRxiv - Neuroscience 2023Quote: ... The blot was washed 3 times with TBST for 5 minutes and was incubated with 10 mL of 3% BSA/TBST (w/v) with 1 µL anti-mouse-HRP secondary antibody (1:10,000; Bio-Rad, 170-6516) for 30 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was 1:4 diluted in water and mixed with SYBR® Green (Bio-Rad) and the appropriate primers at 5µM ...
-
bioRxiv - Plant Biology 2023Quote: ... for 1 h at 4 °C and incubated with protein-G magnetic beads (Bio-rad) for 0.5 h at 4 °C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Genetics 2023Quote: ... China) using TBE (65 mM Tris-HCl, 27 mM boric acid, 1 mM EDTA, pH 9; Bio-Rad, Hercules, CA, USA) as the buffer ...
-
bioRxiv - Microbiology 2020Quote: ... boiled and electrophoresed on 12% vol vol−1 and 4% vol vol−1 acrylamide SDS-PAGE gels (Bio-Rad Laboratories, Canada) on MiniProtean® camera (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... All slides were subsequently blocked with 4% BSA and 1% Triton X-100 in PBS and incubated with rat anti-CD68 (1:500; Bio-Rad) and mouse-anti-GFP conjugated to Alexa Fluor 488 (1:250 ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 µg of plasmid DNA were bound to 3 mg gold micro-carriers (1 µm, Bio-Rad) by adding 50 µL of 2.5 M CaCl2 and 20 µL of 0.1 M spermidine ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated in 8% SDS-PAGE mini-gel (Bio-Rad), blotted to PVDF membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... DNA molecular weight standard (BioRad, CHEF DNA size 8-48-kb) was used as reference.
-
bioRxiv - Evolutionary Biology 2020Quote: ... then to 97°C for 8 min in a thermocycler (BioRad). We centrifuged the samples and froze the supernatant for further use.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were analyzed in quadruplicate on 8-16% TGX gels (BioRad) that had previously been equilibrated in 0.5X TBE for 30 minutes at 150V ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 μl of 10% (w/w) tetramethylethylenediamine (TEMED, BioRad 161-0800) accelerator and 4 μl of 10% (w/w ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... 1/6 of the total amount was loaded on a 4-20% SDS-PAGE (Bio-Rad), while the remaining sample was used for detecting NMNAT2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...
-
bioRxiv - Biochemistry 2023Quote: ... different amounts of TTR1st in the range 0.1 1−1.10 μg were loaded in a native 4-15% PAGE gel (Mini-PROTEAN® TGX™ Precast Gel, Bio-Rad). The gel contained colored molecular weight standards (Precision Plus Protein Dual Color Standards ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 3-HB and n-butanol were separated with 5 mM sulfuric acid as the mobile phase and one of two column conditions: (1) an Aminex HPX-87H or Fast Acids anion exchange columns (Bio-Rad Laboratories) at 35 or 55 °C and a flow rate of 0.6 ml min-1 or (2 ...
-
bioRxiv - Immunology 2021Quote: ... the enzyme reaction was stopped with 50 μL of 1 M sulfuric acid per well and the absorbance was measured in Bio-Rad Model 550 microplate reader (Bio-Rad Laboratories). Sera were assayed in duplicates and antibody titer represents the last reciprocal serum dilution above blank.
-
bioRxiv - Biochemistry 2021Quote: ... Densitometry analysis was carried out using Image Lab (v6.1.0 build 7, Bio-Rad, SG). Briefly ...
-
bioRxiv - Immunology 2022Quote: ... cell debris was removed by centrifugation and clear supernatants were diluted 10-fold and subjected to anion exchange chromatography on gravity fed columns using AG-1 9 8 resin (formate form, 100–200 mesh size, Bio-Rad Laboratories, Hercules, CA). Fractions containing inositol mono ...
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected with 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad). The CA levels from cells were normalized relative to GAPDH levels ...
-
bioRxiv - Neuroscience 2019Quote: ... then 3 washes in 1% milk were performed prior to imaging the blot with ECL (BioRad Clarity #1705060). Membrane was stripped using the GM Biosciences One Minute Advance Stripping buffer #GM6031 ...
-
bioRxiv - Neuroscience 2020Quote: ... Three replicas of 1.5μl of a 1:3 dilution of cDNA were amplified using SsoFast EvaGreen Supermix (BioRad) for FACS-sorted microglia and Power SYBR Green (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 1◻h incubation at 4◻°C with HRP-conjugated goat anti-mouse (1:5000 dilution in 1% YE in PBS-T, BioRad #170–6516) secondary antibody ...
-
bioRxiv - Bioengineering 2020Quote: ... Membranes were incubated with primary antibodies overnight at 4°C and for 1 h at room temperature (RT) with secondary horseradish peroxidase conjugated antibodies (Bio-Rad, 1:3000). Membranes were then developed using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed again with 1x PBS-T (0.075 %) 3 times 10 minutes each and incubated with 1:1 ECL chemiluminescence solution (Clarity Western ECL, #170-5061, Bio-Rad Laboratories, Hercules, CA, USA). Signal was detected using an Amersham AI600 imager (Supplementary Table 5).
-
bioRxiv - Microbiology 2021Quote: ... and then incubated for at least 16 hours at 4°C with either mouse monoclonal anti-His (1:2,000; AD1.1.10, Biorad) or mouse anti-RNA pol (1:5,000 ...