Labshake search
Citations for Bio-Rad :
351 - 400 of 9008 citations for 7 7a Dihydro 2 2 4 6 6 pentamethyl 1 3 benzodioxol 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Molecular Biology 2022Quote: ... and added to 7 cm ReadyStrip IPG Strips with a linear pH range of 3-10 (BioRad) for passive rehydration overnight at 20 °C in a Protean IEF Cell equipment (BioRad) ...
-
bioRxiv - Biophysics 2023Quote: Apoptosis was probed using the Bio-Rad Magic Red Caspase 3-7 kit (Bio-Rad, ICT 935). HEK 293T cells stably expressing FGFR1-YFP were seeded in 96 well plates and allowed to grow to ∼70% confluency ...
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... was run with a 1% agarose TBE gel over 24 hours (Initial switch 1 sec, final switch 25 sec, 6 volt/cm, 120° included angle, Chef III, Bio-Rad, Hercules, CA, USA) with Midrange PFG and Lambda PFG markers (N0342S ...
-
bioRxiv - Developmental Biology 2022Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Nuclear and cytosolic fractions of iPSCs-differentiated cells were acquired using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific #78833 ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were subsequently blocked for 2 h at room temperature with 5% non-fat milk (Bio-Rad, Hercules, CA, USA) or 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Protein samples were loaded on 4-15% polyacrylamide gels (BioRad ...
-
bioRxiv - Genomics 2023Quote: ... 5′-CCCCCCATCTGATCTGTTTCAC-3′) by qPCR using SsoFast EvaGreen Supermix (BioRad), according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2020Quote: ... cells were resuspended in agarose insert buffer and mixed 1:1 with 2% low-melting agarose (Bio-Rad). Gel inserts were solidified at 4°C for overnight and were stored in agarose insert buffer until analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were incubated shaking for 1 hour at RT with 4% blocking solution (5% milk powder (BioRad) in TBS-T) ...
-
bioRxiv - Microbiology 2020Quote: ... concentration of total aerobic GNB and of MDR-GNB were determined by plating serial dilutions (pure, 10−2, 10−4) of initial faeces or EA sample onto Drigalski agar (Bio-Rad) with or without 1mg/L cefotaxime ...
-
bioRxiv - Biophysics 2020Quote: ... Inputs (2 μl) and elutions (10 μl) samples were analyzed by 4-15% SDS-PAGE (MINI-PROTEAN TGX stain-free, Bio-Rad) and staining with Quick Coomassie (Generon ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... The concentration of Amphipol 8-35 was brought up to 35mg/ml and incubated at room temperature for 4 hours then Bio-Beads SM-2 (Bio-Rad) were added and incubated for 16 hours at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second serum panel (n=29 ...
-
bioRxiv - Microbiology 2022Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 29 sera collected from individuals 1 month after BA.5-bivalent-booster of Pfizer or Moderna vaccine ...
-
bioRxiv - Microbiology 2023Quote: ... This panel had been tested negative for SARS-CoV-2 nucleocapsid protein expression using Bio-Plex Pro Human IgG SARS-CoV-2 N/RBD/S1/S2 4-Plex Panel (Bio-rad). The second panel consisted of 20 sera from individuals who were previously infected by SARS-CoV-2 vaccinated with 2-4 doses of parental mRNA vaccine ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% of total input and 15% of total IP fraction were resolved on 10% SDS-PAGE gels and wet transferred onto a 0.45 µm nitrocellulose membrane for 2 h at 80 V and 4°C (Bio-Rad, Germany). The membrane was blocked for 1 h in 5% BSA in PBST (PBS + 0.2% Tween20) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The samples were then transferred to a PVDF membrane at 400mA for 2 hours at 4°C in 1x Tris/Glycine buffer (1610771, Bio-Rad). Membranes were then blocked in casein blocking buffer (PI37528 ...
-
bioRxiv - Genetics 2023Quote: ... and Quantity One 1-D analysis software (Bio-Rad). Band density was normalized to the background and statistically analyzed by Student’s t-test in Prism 9 software.
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were heated to 50°C for 2 to 3 min before the addition of 40 μl molten CleanCut agarose (Bio-Rad 1703594), vortexed vigorously for 5 sec before pipetting in plug mould (Bio-Rad 1703713) ...
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). All reactions were run in triplicate and at least 3 independent RNA preparations were analysed for each sample.
-
bioRxiv - Developmental Biology 2021Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression was normalised to the ribosomal protein Rpl4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Chromo 4 instrument running Opticon 3 software (Bio-rad). Gene expression relative to actb2 or ef1a was calculated using the Livak 2−ΔΔCq method.
-
bioRxiv - Cell Biology 2019Quote: ... and 2% bis-acrylamide (Bis) (1610142, Biorad) which resulted in different modulus of the PA gels ...
-
bioRxiv - Cell Biology 2020Quote: ... Bio-Beads SM-2 Adsorbents from Biorad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 50 mg of Biobeads SM-2 (BioRad) were added to remove detergent and promote protein insertion into liposomes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... containing 2 g Chelex-100 resin (BioRad) to remove divalent metals ...
-
bioRxiv - Biophysics 2021Quote: ... and 2 μL β-mercaptoethanol (Bio-Rad) were added to 30 μL of sample ...
-
bioRxiv - Biophysics 2021Quote: ... 2% bis-AA (BioRad, Cat#161–0142) as described elsewhere 48 ...