Labshake search
Citations for Bio-Rad :
601 - 650 of 8210 citations for 6H Pyrrolo 1 2 1 2 imidazo 4 5 f 2 1 3 benzoxadiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and sets of gene-specific forward and reverse primers (ABCA1, CCL-2) (Bio-Rad) and subjected to real-time PCR quantification using the CFX384 Real Time PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 hours at room temperature and developed with ECL (Biorad 40-720-71KIT). Blots were quantified using FIJI software.
-
bioRxiv - Biochemistry 2021Quote: ... followed by detergent removal using 0.8 mg pre-washed Biobeads SM-2 (Bio-Rad) per ml of reaction mix for 2 hours at RT while slowly rolling ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was reverse-transcribed (2 ug) into cDNA (iScript kit, BioRad Laboratories, Hercules, CA) and analyzed by qRT-PCR ...
-
bioRxiv - Biochemistry 2020Quote: ... The detergent/lipid/enzyme solution was mixed with SM-2 bio-beads (Bio-Rad) for 2 h at 4 0C to remove the detergent ...
-
bioRxiv - Biophysics 2021Quote: ... Detergent was removed with four rounds of incubation with SM-2 beads (Bio-Rad) at 80mg beads per 1 mL of liposome suspension (2 hrs at 23°C twice ...
-
bioRxiv - Biophysics 2020Quote: ... Triton X-100 was then removed by adding BioBeads SM-2 absorbent beads (BioRad) at a Bio-Beads/Triton X-100 ratio of 10 (wt/wt ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 to 15 µl of samples were dotted onto a nitrocellulose membrane (Bio-RAD). We used a concentration of 6E10 antibody of 1:2000 (Biolegend® ...
-
bioRxiv - Bioengineering 2022Quote: ... using the primers listed in Supplementary Table 2 using SsoFast EvaGreen Supermix (Bio-Rad). The expression of the respective gene of interest was normalized to the samples’ respective GAPDH expression using the ΔCt or ΔΔCt method as indicated in the figures ...
-
bioRxiv - Biochemistry 2021Quote: ... pH 7.5 and loaded onto a 2 ml CHT2-I hydroxyapatite column (Bio-Rad) equilibrated in 20 mM HEPES ...
-
bioRxiv - Microbiology 2021Quote: ... cell lysates and immunoprecipitates on beads were resuspended in 2× Laemmli buffer (Bio-Rad) and subjected to SDS-PAGE and western blot analysis.
-
bioRxiv - Bioengineering 2021Quote: ... 2% milk solution was prepared by dissolving nonfat dry milk powder (Bio-rad, UK) in distilled water and this solution was mixed with equal volume of 2% ...
-
bioRxiv - Neuroscience 2019Quote: ... Bound proteins were eluted in 2 × Laemmli sample buffer (Bio-Rad, Cat# 161-0737) containing 5% 2-mercaptoethanol by heating at 95 °C for 5 minutes ...
-
bioRxiv - Cancer Biology 2019Quote: ... sections were blocked with 2% milk powder (blotting grade; Bio-Rad Laboratories, Hercules, USA) in PBS for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: These reactions were undertaken on a DNA Engine Tetrad 2 Thermal Cycler (Bio-Rad), with MyTaq HS DNA polymerase ...
-
bioRxiv - Plant Biology 2022Quote: ... Extracted proteins were further purified using the BioRad ReadyPrep 2-D Cleanup Kit (BioRad), approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad ...
-
bioRxiv - Plant Biology 2022Quote: ... Luminescence intensities mm-2 were evaluated using the Image Lab software (BioRad, Feldkirchen, Germany).
-
bioRxiv - Microbiology 2022Quote: ... The cells:DNA mix was transferred to a 2 mm electroporation cuvette (Bio-Rad #1652082) and electroporated at 2500 kV ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gel was dried for 2 h on a Gel Dryer 583 (Bio-Rad) and visualized after appropriate exposure on a Phosphorimager (FLA-3000 Series ...
-
bioRxiv - Immunology 2022Quote: ... and then blotted for 2 hours onto 0.45 μm supported nitrocellulose membranes (Bio-Rad). Membranes were blocked for one hour using 5% Bovine Serum Albumin (BSA ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... membranes were incubated for 2 minutes with Clarity Western ECL Blotting Substrate (Bio-Rad) and proteins visualized on ChemiDoc (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2023Quote: ... then 2 ul of normalized RNA were mixed with iTaq Universal SYBR (Bio-Rad) and primers for c-Myc (F ...
-
bioRxiv - Biochemistry 2023Quote: ... detergent was removed by overnight incubation with activated Bio-Beads SM-2 (Bio-Rad). For purification of PhuR-containing nanodiscs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and sheep polyclonal against Trans-Golgi network integral membrane protein 2 (TGN46; Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and re-suspended in 2x Laemmli sample buffer containing 2% SDS (Biorad, catalog #: 1610737). Protein concentration was measured by MicroBCA assay (Thermo Scientific ...
-
bioRxiv - Biophysics 2023Quote: ... Afterwards the samples were incubated with Bio-Beads SM-2 sorbent (Bio-Rad Laboratories) overnight on the rolling bank at 4°C to remove the detergent (Rigaud et al ...
-
bioRxiv - Microbiology 2024Quote: ... The assays were incubated for 2 hours at 37 °C in a thermocycler (Biorad). Samples were then filtered through 3 kDa filter plates and derivatized with 4,5-dimethoxy-1,2-phenylenediamine hydrochloride (DMB) ...
-
bioRxiv - Plant Biology 2024Quote: ... This mixture was transferred to a 2 mm ice cold electroporation cuvette (Bio-Rad). Transformation of WT P ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins bound to Dynabeads were eluted with 2 x Laemmli sample buffer (Bio-Rad) and subjected to immunoblot analysis ...
-
bioRxiv - Microbiology 2024Quote: ... the beads and total lysate were resuspended in 2× Laemmli sample buffer (Bio-Rad) supplemented with 5% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein samples were diluted (3:1) with a 4x Laemmli sample buffer (Biorad, Cat# 1610747) and heated at 98 °C for 5 min ...
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... diluted to 1:5,000 in 1X TBST 5% milk powder for 1 hour before visualisation with Clarity™ Western ECL Substrate (Bio-Rad, Hercules, California, US) using a Syngene G ...
-
bioRxiv - Neuroscience 2020Quote: ... Nonspecific binding was blocked for 1 hr at RT with 5% BLOTTO (Bio-Rad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Neuroscience 2020Quote: ... After 1 hour blocking in 5% non-fat milk solution (Bio-Rad 170-6404) at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked for 1 hr using 5% non-fat dry milk (Bio-Rad) and incubated with primary antibody overnight at 4 °C ...
-
bioRxiv - Bioengineering 2019Quote: ... Membranes were blocked for 1 h with 5% fat free milk powder (Bio-Rad) in TBS + 0.05% tween-20 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2019Quote: ... Nonspecific binding was blocked for 1 h at room temperature with 5% blotto (Biorad) in Tris-buffered saline with 0.1% Tween (TBST) ...
-
bioRxiv - Microbiology 2021Quote: ... Lysates were boiled for 5 min in 1 x Laemmli Sample Buffer (Bio-Rad) containing 5% β-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was diluted 1:5 and SsoFast EvaGreen Supermix was used (BioRad, California, USA). BipA was used as a housekeeping gene.102 Each repeat was performed in a single qPCR plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Cancer Biology 2019Quote: ... and F4/80 (Cl:A3-1, Bio-Rad, 1:1000) staining were performed by the Duke Pathology core (Durham ...
-
bioRxiv - Systems Biology 2023Quote: ... F4/80 (Bio-Rad, clone: Cl:A3-1, 1:80), TIM4 (BioLegend ...
-
bioRxiv - Microbiology 2024Quote: ... anti-WC-1 (Bio-Rad, MCA838GA, dilution 1:20) and anti-Pax5 (Agilent DAKO ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was 1:4 diluted in water and mixed with SYBR® Green (Bio-Rad) and the appropriate primers at 5µM ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Plant Biology 2023Quote: ... for 1 h at 4 °C and incubated with protein-G magnetic beads (Bio-rad) for 0.5 h at 4 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 μg of eluted RNA was used for cDNA synthesis employing iScript (Bio-Rad). Samples were analyzed using SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: Cell lysates were harvested by directly lysing the cells with 2 × sampling buffer (Bio-Rad). Proteins were separated by SDS-PAGE ...