Labshake search
Citations for Bio-Rad :
551 - 600 of 8210 citations for 6H Pyrrolo 1 2 1 2 imidazo 4 5 f 2 1 3 benzoxadiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Detergent was then removed by mixing with Bio-Beads SM-2 (Bio-Rad) for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.035-0.25% N,N-methylenebisacrylamide crosslinker (Bis, 2% w/v stock, 161040, BioRad), 0.06% SDS (5% w/v stock in DI water ...
-
bioRxiv - Molecular Biology 2022Quote: ... FhNEJ-Teg extract was purified using the ReadyPrep 2-D Cleanup Kit (BioRad) and the protein pellets resuspended in rehydration buffer [7 M urea ...
-
bioRxiv - Microbiology 2022Quote: ... after incubation with 4x Laemmli Sample Buffer (BioRad, add. 355 mM 2-mercaptoethanol) at 95°C for 5 min and centrifugation for 10 min at 16 000 xg ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins were eluted with 2 × 35 µl 1x Laemmli sample buffer (BioRad, 1610747) at 95°C.
-
bioRxiv - Neuroscience 2022Quote: ... The PCR was carried out using the DNA Engine Tetrad 2 (Bio-Rad). Cycling conditions for Zmynd11 RT-PCR were as follows ...
-
bioRxiv - Biophysics 2022Quote: ... the sample was subjected to detergent removal with Bio-Beads SM-2 (BioRad). Bio-beads were removed ...
-
bioRxiv - Microbiology 2023Quote: ... 2% formaldehyde gel and transferred to a Zeta-Probe GT membrane (Bio-Rad) via capillary action overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were then mixed directly with SM-2 Biobeads (Bio-Rad, Hercules, CA) for 30 minutes with gentle agitation ...
-
bioRxiv - Microbiology 2023Quote: ... and contained 10 μL of 2× SsoFast EvaGreen® (Bio-Rad, Hercules, CA), forward and reverse primers (0.25 μM each ...
-
bioRxiv - Immunology 2023Quote: VLPs were denatured by heating in 2xLaemmli buffer containing 2-mercaptoethanol (Bio-Rad) for 10 minutes at 95°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were then mixed directly with SM-2 Biobeads (Bio-Rad, Hercules, CA) for 30 minutes with gentle agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2% chelated FCS (Chelex 100 molecular biology grade resin, BioRad, USA), 1% penicillin/streptomycin ...
-
bioRxiv - Biophysics 2023Quote: ... Unconjugated SM(PEG)2 was removed by Econo-Pac 10DG Column (Bio-Rad). The buffer used for column equilibration and sample elution was 0.1 M sodium phosphate (pH 7.3 ...
-
bioRxiv - Biophysics 2022Quote: ... 2% bis acrylamide (1610142) and 40% acrylamide solutions (1610140) were from Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2023Quote: ... Detergent was removed by successive addition of Bio-Beads SM-2 (Bio-Rad) and proteoliposomes were harvested by ultracentrifugation at 200,000g and resuspended into 200 µL of buffer ...
-
bioRxiv - Bioengineering 2023Quote: ... was used to reverse transcribe Caco-2 RNA (C1000 Touch Thermal Cycler, BioRad). The resulting cDNA was cleaned and concentrated (cat no ...
-
bioRxiv - Immunology 2023Quote: ... VLPs were denatured by heating in 4xLaemmli buffer containing 2-mercaptoethanol (Bio-rad) for 10 minutes at 95°C ...
-
bioRxiv - Biochemistry 2023Quote: ... The detergent was removed by sequentially adding Bio-Beads SM-2 (Bio-Rad) and incubating overnight at 4 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... and loaded onto 2 mL Nuvia IMAC Ni-charged resin (Bio-Rad Laboratories). The resin was washed with 10 column volumes of buffer containing 5 mM imidazole ...
-
bioRxiv - Biophysics 2023Quote: ... The motility surface was coated with 0.8% anti-tubulin antibody (BioRad YL1/2) in BRB-80 buffer for 5 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... and 7.5 ul of 2× iQ SYBR green super mix (Bio-Rad Laboratories) was used.
-
bioRxiv - Biochemistry 2023Quote: ... The pentaethylene glycol monodecyl was removed by SM-2 bio-beads (Bio-Rad): five additions of bio-beads were made to the master mix every 20 minutes with inversion at 4 °C ...
-
bioRxiv - Immunology 2024Quote: VLPs were denatured by heating in 2xLaemmli buffer containing 2-mercaptoethanol (Bio-Rad) for 10 minutes at 95°C ...
-
bioRxiv - Neuroscience 2024Quote: ... at 250 mA for 2 h using the wet transfer method (Bio-Rad Mini Trans-Blot Electrophoretic Cell 170-3930) ...
-
bioRxiv - Microbiology 2024Quote: ... 2% formaldehyde gel and transferred to a Zeta-Probe GT membrane (Bio-Rad) via capillary action overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... for 2 min and imaged on a ChemiDoc Touch Imaging System (Bio-Rad). To normalize to total protein concentration ...
-
bioRxiv - Microbiology 2024Quote: ... for 2 h and imaged by a ChemiDoc MP Imaging System (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Neuroscience 2024Quote: ... consisting of 4% (vol/vol) of 19:1 acrylamide/bis-acrylamide (BioRad, 1610144), 60 mM Tris⋅HCl pH 8 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... All cDNA samples were diluted 1:5 and 1 μL was used in quantitative PCR (qPCR) reactions with iTaq Universal SYBR Green Supermix (Bio-Rad, #1725124), according to manufacturer’s instruction and using the Applied Biosystems QuantStudio 7 flex qPCR System ...
-
bioRxiv - Genetics 2020Quote: ... and ligated to MseI and EcoRI adaptors (Supplementary Table 4) at 37° C for 2 h in a T100™ Thermal cycler (Bio-Rad Laboratories, Hercules, CA). Success of the digestion/ligation reaction was confirmed on 1.5% of agarose gel electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by 1◻h incubation at 4◻°C with HRP-conjugated goat anti-mouse (1:5000 dilution in 1% YE in PBS-T, BioRad #170–6516) secondary antibody ...
-
bioRxiv - Bioengineering 2020Quote: ... Membranes were incubated with primary antibodies overnight at 4°C and for 1 h at room temperature (RT) with secondary horseradish peroxidase conjugated antibodies (Bio-Rad, 1:3000). Membranes were then developed using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: ... Gr-1 (1:500, MCA2387, Bio-Rad), Fluorescein labeled DBA-lectin (1:500 ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genomics 2024Quote: ... samples were embedded in a thin polyacrylamide film by inverting them onto a GelSlick-coated microscope slide with a droplet of 4% acrylamide solution (4% v/v 20:1 acrylamide:bis-acrylamide [BioRad, 1610144] with 0.15% v/v TEMED [Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... After being blocked with TBST (1%) containing 5% blotting-grade blocker (Bio-Rad), the membranes were incubated overnight with primary antibodies against target molecules at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked in 5% nonfat dry milk for 1 hour (Bio-Rad) and incubated gently shaking overnight at 4°C in 1° antibody/PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 1 h with 5% non-fat milk (Bio-Rad Laboratories) or BSA (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked for 1 h with 5% nonfat milk powder (Bio-Rad) in TBS + 0.05% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% Tween]) or for 5 min in EveryBlot blocking buffer (Bio-Rad, #12010020) before proceeding to primary and HRP secondary antibody staining in the respective blocking buffers ...
-
bioRxiv - Microbiology 2023Quote: ... sheep polyclonal anti-GFP (Bio-Rad, 4745-1051, 1:1000, 5 µg/mL), and rabbit polyclonal anti-GFP (Novus Biologicals ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed again with 1x PBS-T (0.075 %) 3 times 10 minutes each and incubated with 1:1 ECL chemiluminescence solution (Clarity Western ECL, #170-5061, Bio-Rad Laboratories, Hercules, CA, USA). Signal was detected using an Amersham AI600 imager (Supplementary Table 5).
-
bioRxiv - Cell Biology 2022Quote: ... Protein lysate (30 μg) with 2X Laemmli buffer (in 1:1 ratio) was loaded onto a 4%–20% gradient gel (Bio-Rad, Mississauga, ON, Canada). The gel was transferred onto a PVDF membrane using the Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Cell Biology 2019Quote: ... and the beads were washed with buffer #2 in Poly-Prep columns (Bio-Rad). Complexes were eluted in two fractions with buffer #2 supplemented with 2.5mM D-biotin ...
-
bioRxiv - Cell Biology 2020Quote: ... and sets of gene-specific forward and reverse primers (ABCA1, CCL-2) (Bio-Rad) and subjected to real-time PCR quantification using the CFX384 Real Time PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 hours at room temperature and developed with ECL (Biorad 40-720-71KIT). Blots were quantified using FIJI software.
-
bioRxiv - Biochemistry 2021Quote: ... followed by detergent removal using 0.8 mg pre-washed Biobeads SM-2 (Bio-Rad) per ml of reaction mix for 2 hours at RT while slowly rolling ...
-
bioRxiv - Cancer Biology 2019Quote: ... RNA was reverse-transcribed (2 ug) into cDNA (iScript kit, BioRad Laboratories, Hercules, CA) and analyzed by qRT-PCR ...