Labshake search
Citations for Bio-Rad :
151 - 200 of 1745 citations for 6 chloro 5 iodonicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... containing 5% β-mercaptoethanol (Bio-Rad, 1610710), boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... + 5 % βmercapto-ethanol (BioRad ref #161-0710), and heated for 5 min at 70°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% nonfat dry milk (BioRad), and probed with either anti-phospho-p38 MAPK (Thr180/Tyr182 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2020Quote: ... The adaptor was cleaned up on a Micro Bio-Spin 6 chromatography column (Bio-Rad) equilibrated with water ...
-
bioRxiv - Microbiology 2019Quote: ... Excess [γ-32P] ATP was removed with a Bio-Spin 6 column (Bio-rad, CITY). Followed by heat inactivation ...
-
bioRxiv - Biochemistry 2022Quote: ... with the mini profinity IMAC and mini Bio-Gel P-6 desalting cartridges (Bio-Rad). The protein concentration and purity were verified by Bradford Protein Assay (Bio-Rad ...
-
bioRxiv - Biochemistry 2022Quote: ... 10mM BME) at room temperature using Micro Bio-Spin 6 columns (Bio-Rad CAT# 7326200). PARLSkd3 concentration was measured via A280 and the molar extinction coefficient and PARLSkd3 concentration was adjusted to 30 μM ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 6 μl freshly prepared Ammonium persulfate (Bio-Rad, 10 mg in 100μl distilled water) were added to the solution and mixed ...
-
bioRxiv - Neuroscience 2020Quote: ... and 10 μg of protein was loaded onto an acrylamide gel (6–15%; Bio-Rad). Gel electrophoresis was performed in Tris- glycine-sodium dodecyl sulfate (SDS ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Beads SM-2 Resin and Bio-Gel P-6 were obtained from Bio-Rad Laboratories Inc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... Labeled probes were then purified using Micro Bio-Spin 6 Chromatography Column (BioRad, Berkeley, CA), and 1 μl of the probe was counted for subsequent radioactivity dilution calculations ...
-
bioRxiv - Biophysics 2020Quote: ... 0.5% n-dodecyl-β-D-maltoside using a Bio-Spin 6 desalting column (Bio-Rad). CmeC (5 μM ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was diluted 1:6 and run with iTaq Universal SYBR Green Supermix (Bio-Rad) on ViiA 7 Real-Time PCR System according to manufacturer protocol ...
-
bioRxiv - Biophysics 2022Quote: ... The modified probes were purified using a P-6 Micro Bio-Spin Column (Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... The RNA probe was purified using Micro Bio-Spin™ P-6 Gel Columns (Biorad), denatured 5 min in 95°C and cooled on ice ...
-
bioRxiv - Immunology 2022Quote: ... using the magnetic rack (6-Tube SureBeads™ Magnetic Rack #1614916 BIORAD Hercules, CA, USA) to magnetized them ...
-
bioRxiv - Microbiology 2023Quote: ... anti-CD45-APC (clone UM16-6, LYNX Rapid APC Antibody Conjugation Kit, both Bio-rad) and thrombocyte marker K1-PE (LYNX Rapid RPE Antibody Conjugation Kit ...
-
bioRxiv - Cancer Biology 2020Quote: ... lysate concentrations were adjusted to equal protein concentrations using the bicinchoninic acid (BCA) protein assay (Biorad). Equal amounts of protein were mixed to a final concentration of 1x reducing sample buffer (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... boric acid) Urea solutions were made fresh daily and incubated with AG 501-X8 resin (Biorad) for minimum 5 hours to remove ionic contaminants ...
-
bioRxiv - Microbiology 2022Quote: ... An Aminex HPX-87H Organic Acid Analysis Column (300 × 7.8 mm; Bio-Rad, Hercules, CA, USA) was equilibrated with 5 mM H2SO4 (Titrisol ...
-
bioRxiv - Biochemistry 2019Quote: The acetic acid was quantified using an Aminex HPX-87H (300 x 7.8 mm, Bio-Rad) column with a Carbo-H precolumn (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: Nucleic acids (RNA or DNA) samples were loaded in Bio-Dot SF Microfiltration Apparatus (Bio-Rad) and allowed to bind onto the membrane ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were washed 5 time for 5 minutes with PBST and incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (Biorad) for 2 hours at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Plant Biology 2019Quote: 5 % Mini-PROTEAN TBE precast gels (Bio-Rad) have been pre-electrophoresed in 0.5x TBE buffer for 60 minutes at 70 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... loaded onto a 5% polyacrylamideTBE gel (Bio-Rad) that had been pre-run for 15 minutes in TB Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% powdered milk (Bio-Rad 170-6404) resuspended in 1x TBST ...
-
bioRxiv - Genomics 2019Quote: ... Blocked membrane in 5% Blotting-Grade Blocker (BioRad) in TBS-T (50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Pathology 2022Quote: ... with 5% 2-Mercaptoethanol (Bio-Rad, 161-0710) and subjected to electrophoresis ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...