Labshake search
Citations for Bio-Rad :
1 - 50 of 1745 citations for 6 chloro 5 iodonicotinic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: ... Alkaline phosphatase was developed with 5-bromo-4-chloro-3-indolyl phosphate and Nitroblue tetrazolium (BCIP/NBT; BioRad, Germany) as substrate ...
-
bioRxiv - Microbiology 2023Quote: ... were detected as dark spots after a 10-min reaction with 5-bromo-4-chloro-3-idolyl phosphate and nitro blue tetrazolium using an alkaline-phosphatase-conjugate substrate (Bio-Rad, CA, USA). SFUs were counted using the AID ELISpot Reader System (Autoimmun Diagnostika) ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mM ATP) using Micro Bio-Spin 6 columns (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Microbiology 2020Quote: ... CFSE (5[6]-Carboxyfluorescein Diacetate Succinimidyl Ester) cell proliferation kit purchased from Bio-Rad. CFSE cell proliferation kit was excited on 492 nm ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed with TBST (6 × 5 min) and developed using Clarity Western ECL Substrate (Bio-Rad, California, US). Images were captured with ChemiDoc XRS+ system (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was washed with the washing solution twice and then reacted with 4-chloro-1-naphthol (Bio-Rad Laboratories) in the HRP color development buffer (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... folic acid 500 μg/L) or on Columbia agar solid support enriched with 5% horse blood (COH) (Biorad). Anoxic conditions were generated in Gaspack (BD ...
-
bioRxiv - Neuroscience 2022Quote: ... then washed 6 x 5 minutes with TBS-T before developing with Clarity Western ECL Substrate (Bio-rad).
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were biolistically transfected after 5-6 days in vitro using a Helios Gene Gun (120 psi; Bio-Rad) with pLenti-hSyn-eNpHR3.0-EYFP (eNpHR3.0 fused to EYFP and driven by the human synapsin I promoter ...
-
bioRxiv - Biophysics 2021Quote: ... Micro Bio-Spin 6 Columns (molecular weight cutoff 6 kDa; Bio-Rad) were used at 1,000 × g and 4 °C to exchange purified protein samples to 250 mM ammonium acetate (99.99 % purity ...
-
bioRxiv - Biochemistry 2023Quote: ... followed by heat-inactivation at 75°C for 5 min and desalting using Micro Bio-Spin P-6 columns (Bio-Rad, 7326221). Dephosphorylated guide RNAs were then radiolabeled using T4 Polynucleotide Kinase (0.33 U/µL ...
-
bioRxiv - Biochemistry 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house;) ...
-
bioRxiv - Plant Biology 2021Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house) ...
-
bioRxiv - Biochemistry 2019Quote: ... using a Biospin-6 (BioRad) column and introduced directly into the mass spectrometer using gold-coated capillary needles (prepared in-house ...
-
bioRxiv - Cell Biology 2019Quote: ... The bicinchoninic acid assay (Bio-Rad) was used to measure protein concentration from the cell lysates and 20 μg of protein was loaded onto 8% SDS gels and electrophoresed ...
-
bioRxiv - Neuroscience 2024Quote: ... Microplate manager 6 software (MPM6 Biorad) was used for plate reading.
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Microbiology 2020Quote: ... pH6.9 using a micro biospin 6 column (Bio-Rad). The FOS sample was diluted to ∼500 µM with 0.5 M ammonium acetate ...
-
bioRxiv - Microbiology 2020Quote: ... and Bio-Plex Manager software (v.6, Bio-Rad). The data were expressed as median fluorescence intensity (MFI ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Cell Biology 2020Quote: Protein bands intensities were quantified with Image Lab 6 (BioRad). Equal rectangles were drawn around the total protein gel lane and the band of interest ...
-
bioRxiv - Biochemistry 2019Quote: ... BioSpin 6 desalting columns were purchased from BioRad (Hercules, CA). Diethylamine NONOate (DEA NONOate) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 6 μL of Sybr Green Super Mix 2X (Bio-Rad), 2,6 μl MQ H2O.
-
bioRxiv - Molecular Biology 2020Quote: ... resolving gels between 6% and 15% acrylamide/bis-acrylamide (BioRad) were used ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD, Hercules, CA, USA) for 30’ at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Unreacted linker was separated with Bio-Spin 6 columns (BioRad), that were previously equilibrated in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... the samples were desalted using Biospin 6 columns (BioRad, CA), equilibrated with 50 mM triethylammonium bicarbonate and 0.02%(w/v ...
-
bioRxiv - Biochemistry 2022Quote: ... then desalted with Micro Bio-Spin 6 columns (Bio-Rad). To 22.5 μL of the resulting solutions was added KCl (final concentration 100 mM ...
-
bioRxiv - Plant Biology 2021Quote: ... the gel was rinsed with acetic acid/methanol (Destain, Bio-Rad). Each lane was cut into 4 bands ...
-
bioRxiv - Microbiology 2020Quote: ... 10% acetic acid v/v and brilliant Coomassie blue (BioRad G250). For Western blotting ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 10% glacial acetic acid and imaged on a GelDoc (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentration was determined by the bicinchoninic acid assay (Bio-Rad), and the purified proteins were stored at −80°C until used.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... the samples were incubated with 6× Laemmle Sample Buffer (Bio-Rad) with 10% β-mercaptoethanol and boiled for 5 min at 100°C ...
-
bioRxiv - Biochemistry 2019Quote: ... Following desalting with Micro Bio-spin 6 chromatography columns (Bio-Rad) twice ...
-
bioRxiv - Biochemistry 2019Quote: ... pH 7.0 by passing through a MicroBioSpin-6 column (Bio-Rad), diluted 100-fold with the same buffer ...
-
bioRxiv - Physiology 2020Quote: ... followed by RNA purification with Micro Bio-spin 6 columns (BioRad).
-
bioRxiv - Microbiology 2021Quote: ... and then run through Bio-Spin 6 columns (Bio-Rad #7326002) twice ...