Labshake search
Citations for Bio-Rad :
201 - 250 of 2921 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 5% blotting grade blocker (Bio-Rad, 1706404XTU). The primary antibodies used are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantum™ FITC-5 MESF beads (BioRad) were used according to the manufacturer’s protocol to estimate the length of telomeres quantitatively ...
-
bioRxiv - Microbiology 2023Quote: ... After blocking with 5% BSA (BIO-RAD) in 1 X PBS at room temperature for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% blocking protein (Bio-Rad) at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2021Quote: After running through 8% SDS-polyacrylamide (SDS-PAGE; made in house) by gel electrophoresis (BioRad, Hercules, CA, USA), the proteins were transferred ...
-
bioRxiv - Microbiology 2019Quote: ... Total cell lysates were separated on 8-12% SDS-PAGE gels and transferred to PVDF membranes (Bio-Rad). Membranes were blocked with TBST with 5% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... were resolved on 8-12% Tris-glycine SDS-polyacrylamide gels and transferred to nitrocellulose blotting membranes (Bio-Rad), following standard procedures ...
-
bioRxiv - Microbiology 2021Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini-Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Plant Biology 2021Quote: ... were loaded onto an 8-channel DG8TM cartridge for droplet generation in the QX200 Droplet Generator (Bio-Rad). Droplets were transferred into a 96-well plate (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... SDS-PAGE was performed using 8-16% gradient gel and transferred to nitrocellulose paper using the Transblot (BioRad). Western blots were carried out using iBind with 1 ug/ml primary antibodies and 1 ug/ml secondary antibodies following iBind protocol (Invitrogen/ThermoFisher).
-
bioRxiv - Genomics 2020Quote: ... quantifying 8 mRNAs and 10 circRNAs of interest with the SsoAdvanced™ Universal SYBR Green Supermix (BioRad, USA). All reactions were performed in 384-well plates on the LightCycler480 instrument (Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... samples were buffer exchanged into 150 mM of ammonium acetate pH 8 using Bio-Spin P6 columns (BioRad) and the final protein concentrations were adjust to 1-5 µM ...
-
bioRxiv - Microbiology 2022Quote: ... Cell lysates and virion lysates were resolved on 8 to 16% Mini- Protean TGX precast gels (Bio-Rad), transferred onto nitrocellulose membranes (GE Healthcare ...
-
bioRxiv - Immunology 2020Quote: ... 8 ng of granuloma protein was loaded per lane into Any kD Mini-PROTEAN TGX gels (Bio-Rad), separated by SDS-PAGE and transferred to 0.2 μm nitrocellulose membranes (Bio-Rad) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... serum insulin was performed using the Bio-Plex Pro Mouse Diabetes 8-Plex Assay (Bio-Rad, Hercules, CA) as per the manufacturer’s protocol.
-
bioRxiv - Physiology 2022Quote: ... The 8% equivalent of each fraction by volume was run on a 4-15% TGX gel (Bio-Rad) for Western blotting using affinity-purified polyclonal rabbit anti-mouse Prdm13 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 8 μl from each sample were loaded onto Mini Protean TGX Pre-cast 4-15% gels (Bio-Rad) and migration was carried out for approximately 45 min at 150V ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: gp120 or SOSIP glycoproteins were separated on 8–16% SDS-PAGE (mini-PROTEAN TGX protein gels; Bio-Rad) and transferred to a 0.45 μm nitrocellulose membrane (catalog number 1620115 ...
-
bioRxiv - Genomics 2023Quote: ... the ligation products were amplified by 8 cycles of PCR on an S1000 thermocycler (Bio-Rad, Hercules, CA) using Q5 High-Fidelity PCR master mix with HF buffer (NEB Ipswich ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant from two reactions were collected and separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Biophysics 2024Quote: ... 20 µL of the supernatant was taken and added to 8 µL 4X Laemmli sample buffer (Bio-Rad) and 12 µL of 8M urea ...
-
bioRxiv - Bioengineering 2022Quote: ... ddPCR reactions were set up as follows: 11 μL 2×ddPCR™ supermix for probes (no dUTP) (BioRad), 0.2 μL FWD primer (100 μM) ...
-
bioRxiv - Developmental Biology 2022Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Nuclear and cytosolic fractions of iPSCs-differentiated cells were acquired using NE-PER™ Nuclear and Cytoplasmic Extraction Reagents (Thermo Scientific #78833 ...
-
bioRxiv - Neuroscience 2022Quote: ... Blots were washed (3 × 5min TBS-T and 2 × 5 min TBS) before being imaged on the ChemiDoc MP Imaging System (Biorad). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... membranes were subsequently blocked for 2 h at room temperature with 5% non-fat milk (Bio-Rad, Hercules, CA, USA) or 5% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: Whole-cell lysates for immunoblotting were prepared by dissolving cells in Laemmli Sample Buffer containing 5% 2-mercaptoethanol (Bio-Rad). Protein samples were loaded on 4-15% polyacrylamide gels (BioRad ...
-
bioRxiv - Physiology 2023Quote: ... 18 and 21 months of age and were subjected to IEF using a 24 cm immobiline DryStrip (pH 6-11) (BIO-RAD, Hercules, CA), followed by SDS-PAGE using pre-casted 10-16% gradient polyacrylamide gels (BIO-RAD ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Developmental Biology 2019Quote: ... Membranes were washed 5 time for 5 minutes with PBST and incubated with horseradish peroxidase (HRP) conjugated secondary antibodies (Biorad) for 2 hours at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Genetics 2022Quote: ... We washed the membrane 3× 5 minutes in TBS-T and 1× 5 minutes TBS before imaging (Bio-Rad ChemiDoc).
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2024Quote: ... CD68 (1:400, FA-11, BioRad), and NLRP3 (1:500 ...
-
bioRxiv - Plant Biology 2019Quote: 5 % Mini-PROTEAN TBE precast gels (Bio-Rad) have been pre-electrophoresed in 0.5x TBE buffer for 60 minutes at 70 V ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Microbiology 2019Quote: ... loaded onto a 5% polyacrylamideTBE gel (Bio-Rad) that had been pre-run for 15 minutes in TB Buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... in 5% powdered milk (Bio-Rad 170-6404) resuspended in 1x TBST ...
-
bioRxiv - Genomics 2019Quote: ... Blocked membrane in 5% Blotting-Grade Blocker (BioRad) in TBS-T (50 mM Tris pH 7.6 ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...