Labshake search
Citations for Bio-Rad :
51 - 100 of 2921 citations for 6 Dodecyne 5 8 diol 2 5 8 11 tetramethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... Samples were resolved by SDS-PAGE (8-16%, Bio-Rad) and visualized by Coomassie staining ...
-
bioRxiv - Microbiology 2022Quote: Cell lysates were resolved on gradient gels (4-8%; BioRad) and blotted onto nitrocellulose membranes ...
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2-5 min and scanned with GS-800 densitometer (Bio-Rad).
-
TNFR1/p38αMAPK signaling in Nex+ supraspinal neurons regulates sex-specific chronic neuropathic painbioRxiv - Neuroscience 2023Quote: ... Membranes were blocked for 2 hours in 5% non-fat milk (BioRad) in 1x TBS-T (10 mM tris-HCl ...
-
bioRxiv - Immunology 2021Quote: ... Proteins were separated in 8% SDS-PAGE mini-gel (Bio-Rad), blotted to PVDF membrane (Millipore ...
-
bioRxiv - Microbiology 2021Quote: ... DNA molecular weight standard (BioRad, CHEF DNA size 8-48-kb) was used as reference.
-
bioRxiv - Evolutionary Biology 2020Quote: ... then to 97°C for 8 min in a thermocycler (BioRad). We centrifuged the samples and froze the supernatant for further use.
-
bioRxiv - Biochemistry 2022Quote: ... before analysis on 8% SDS-PAGE or gradient (4-15%, BioRad) gels and western blotting using anti-FMRP (Cell signaling #LS-C82231 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and loaded on a 3-8% tris-acetate gel (Bio-Rad) for SDS-PAGE ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were analyzed in quadruplicate on 8-16% TGX gels (BioRad) that had previously been equilibrated in 0.5X TBE for 30 minutes at 150V ...
-
bioRxiv - Cell Biology 2019Quote: ... and loaded onto 3-8% Tris-acetate gels (Bio-rad, #3450131). Purified bovine 19S (UBPbio ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 μl of 10% (w/w) tetramethylethylenediamine (TEMED, BioRad 161-0800) accelerator and 4 μl of 10% (w/w ...
-
bioRxiv - Cell Biology 2022Quote: ... Cell were labelled with rabbit anti-IL-8 antibody (Biorad Biosciences), mouse anti-IL-1β antibody (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were stained with rabbit anti-IL-8 antibody (Biorad Biosciences) and mouse anti-IL-1β antibody (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-alpha-Tubulin (rat, YL1/2, MCA77G, Bio-Rad, 1:2000 (Figure 5) or 1:10000 (other figures) ...
-
bioRxiv - Plant Biology 2023Quote: ... 5 mM 2-mercaptoethanol) and protein concentration measured using Bradford method (Bio-Rad Protein Assay Dye Reagent Concentrate ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 5% (v/v) anhydrous 2-mercaptoethanol (#1610710XTU, Bio-Rad, Hercules, CA, USA). The resulting mixture was then boiled for 15 min and then 35 µl of each sample was loaded into individual wells of 10–20% ...
-
bioRxiv - Biophysics 2024Quote: ... 5% acrylamide (BIORAD), 0.1% SDS ...
-
bioRxiv - Plant Biology 2019Quote: ... 5- to 6-week-old expanded leaves of Arabidopsis plants were bombarded with 1nm gold particles (BioRad) coated with pB7WG2.0-GFP and pB7WG2.0-RFPER ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed with TBST (6 × 5 min) and developed using Clarity Western ECL Substrate (Bio-Rad, California, US). Images were captured with ChemiDoc XRS+ system (Bio-Rad ...
-
bioRxiv - Biophysics 2022Quote: ... Samples were centrifuged for 2 min at 12,000 x g before being separated on 8–16% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad) at 160 V for 60 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein pellet was resuspended in UTC buffer (8 M urea, 2 M thiourea, 4% CHAPS) and quantified using RC DC™ Protein Assay Kit (Bio-Rad). Sample with 80 µg proteins resuspended in rehydration buffer (8 M urea ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA libraries were amplified using 8 PCR amplification cycles (C1000, Bio-Rad). Cluster generation and sequencing was performed using the standard Illumina protocols for Illumina HiSeq 4000 by the University of Chicago Functional Genomics Core facility ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 8 minutes and images were acquired using a ChemiDoc (BIO-RAD). After removal of the Ponceau by washing once with TBS-T (TBS 1X ...
-
bioRxiv - Plant Biology 2021Quote: ... Extracts were resolved on 8% (v/w) SDS-PAGE (1610156, Bio-Rad) and transferred onto a nitrocellulose membrane (0600001 ...
-
bioRxiv - Cancer Biology 2023Quote: ... were loaded onto 3-8% Criterion XT tris-acetate gels (Bio-Rad Laboratories ...
-
bioRxiv - Synthetic Biology 2023Quote: ... in 0.2 ml 8-Tube PCR Strips (Bio-Rad™, clear #TBS0201) with 0.2 ml Flat PCR Tube 8-Cap Strips (Bio-Rad™ ...
-
bioRxiv - Biochemistry 2024Quote: ... proteins were separated by Criterion XT Tris Acetate 3-8% (Bio-rad) SDS-PAGE and visualized by silver staining.
-
bioRxiv - Neuroscience 2022Quote: ... 40 μg of samples 3 were mixed with 2× laemmli buffer + 5% 2-mercaptoethanol (BioRad Laboratories, Hercules, CA). Samples were then briefly vortexed and centrifuged ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1.6 μL H2O and 11 μL 2× ddPCR Supermix (Bio-Rad #1863024). 20 μL of ddPCR mixes were used to generate droplets in a QX200 Droplet Generator (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... plates were stained with primuline (0.05% in acetone/water, 8/2; v/v) and photographed under long-wave UV light (Biorad ChemiDoc XRS Imaging System).
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Neuroscience 2022Quote: ... then washed 6 x 5 minutes with TBS-T before developing with Clarity Western ECL Substrate (Bio-rad).
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were separated on a 3-8% Criterion XT tris-acetate gel (Biorad) or 4-15% Criterion TGX gel according to the instructions of the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 and 8 using a BioRad TC10 Automated cell counter (BioRad Laboratories, Inc). Growth curves were conducted 5-times ...
-
bioRxiv - Plant Biology 2019Quote: ... The proteins were resolved on 8 or 10% SDS-PAGE (1610156, Bio-Rad) and transferred using the wet transfer method onto a nitrocellulose membrane (10600001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Bio-Plex Pro Cell Signaling Akt Panel 8-plex (BioRad, USA; LQ00006JK0K0RR) were used for phosphorylated protein quantification and Bio-Plex Pro Total Akt (BioRad ...
-
bioRxiv - Synthetic Biology 2021Quote: All SDS-PAGE gels contained 8% acrylamide bis-tris (Bio-Rad, pH 6.5). Samples were boiled in 1× Laemmli sample buffer at 90°C for 5 mins before loading to the gels ...
-
bioRxiv - Genomics 2019Quote: ... LIPC_F and LIPC_R (Supplemental Table 8)] by qPCR using SsoFast EvaGreen Supermix (BioRad), according to manufacturer’s protocol.
-
bioRxiv - Biophysics 2020Quote: Polyacrylamide (PAA) substrates were prepared by mixing 8% acrylamide (Bio-Rad, Hercules, CA), 0.1% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... or 0.2 mL white 8-tube PCR strips and optical caps (Bio-Rad). For bacterial cultures ...
-
bioRxiv - Pathology 2023Quote: ... 8 ng of cDNA was used for the SYBR green reagent (BioRad 1725270) reaction for qPCR analysis (BioRad) ...
-
bioRxiv - Molecular Biology 2022Quote: ... proteins were separated using a 8-16% Mini-PROTEAN Precast Protein gels (BioRad) and transferred to Immobilon-P PVDF membrane (Millipore) ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate CriterionTM XT Precast Gels (Bio-Rad Laboratories, Invitrogen) at 150 V for 90 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... avara pased the quality checks (i.e., RIN > 8 in Experion, Bio-Rad, USA). In short ...
-
bioRxiv - Cancer Biology 2024Quote: SDS-PAGE Gels (8% or 10%) were transferred to nitrocellulose membranes (Bio-Rad) using a Trans-blot apparatus (2.5 A constant ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were biolistically transfected after 5-6 days in vitro using a Helios Gene Gun (120 psi; Bio-Rad) with pLenti-hSyn-eNpHR3.0-EYFP (eNpHR3.0 fused to EYFP and driven by the human synapsin I promoter ...