Labshake search
Citations for Bio-Rad :
251 - 300 of 1009 citations for 5α CHOLESTAN 3 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... one or two conventional qPCR were performed in a CFX96 Real-Time System (Bio-Rad) in a 15 μl volume containing diluited cDNA and 7.5 μL iQ EVA Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... and the intensity of each band was quantified using Quantity One software (Bio-Rad Laboratories). For all immunoblot images presented in this manuscript ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... One μg RNA was used for reverse transcription with iScript Reverse Transcription Supermix (Bio-Rad). Real-time polymerase chain reaction was carried out in a final volume of 20 μl with iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... a one-step RT-qPCR reaction with iTaq Universal probe kit (Bio-Rad, Hercules, CA) and primers and probes targeting the DENV2 envelope were used (59) ...
-
bioRxiv - Microbiology 2020Quote: ... Reactions were performed using the iTaq™ Universal Probes One-Step RT-qPCR kit (BioRad), with primers and probes (Integrated DNA Technologies ...
-
bioRxiv - Immunology 2020Quote: ... Autoradiography films were scanned and the bands were quantified using Quantity One 4.4.0 (Bio-Rad) and ImageJ (Rasband ...
-
bioRxiv - Immunology 2021Quote: ... and the amount of packaged DNA was quantified using Quantity One software (Bio-Rad, CA). The packaging efficiency was defined as the number of DNA molecules packaged per T4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the spot density was determined with Quantity One Software (Bio-Rad Laboratories, Hercules, CA). Excel-based data analysis was performed ...
-
bioRxiv - Genetics 2020Quote: ... Densitometric analyses were performed on low exposure images using the Quantity One software (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... and ZIKV and CHIKV gRNA copies with i-Taq one step universal sybr kit (BioRad) with primers detailed in Supplementary Table 5 ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for one hour with Precision Protein Streptactin-HRP conjugate (1:60,000 dilution, Biorad). The membrane was then washed with four 5-minute washes in TBST ...
-
bioRxiv - Neuroscience 2021Quote: ... Bands in the linear range of detection were quantified using Quantity One software (Bio-rad), and the %surface DAT was determined by normalizing surface DAT to its corresponding DAT input signal ...
-
bioRxiv - Biochemistry 2021Quote: ... The gels were scanned using a STORM imager (GMI) and quantified with Quantity One (BioRad).
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of RNA was reverse transcribed by using iScript cDNA Synthesis Kit (Bio-Rad). 10 μl SsoAdvanced Universal SYBR Green Supermix reagents (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... substrate before being imaged on a VersaDoc system with Quantity One analysis software (Bio-Rad). Protein was quantified using densitometry on ImageJ and normalized to tERK accumulation.
-
bioRxiv - Molecular Biology 2020Quote: ... and the intensity of the bands was calculated using the Quantity One software (Bio-Rad).
-
bioRxiv - Cell Biology 2021Quote: ... The intensity of blots was calculated by using the Quantity One software (Bio-Rad Laboratories) and also normalized to β-actin as a loading control.
-
bioRxiv - Cancer Biology 2021Quote: ... on a Bio-Rad Bioluminescence device equipped with Quantity One/Chemidoc XRS software (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... gel imaging system with the Quantity One analysis software version 4.5.1 (Bio-Rad Laboratories, USA) and scored by comparison to a 1kb DNA ladder (PBL ...
-
bioRxiv - Cell Biology 2022Quote: ... The immunoblots were exposed and quantified through the Quantity One program (Bio-Rad, California, USA).
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was carried out using Reliance One-Step Supermix (Bio-Rad; Hercules, CA, USA) to measure total viral N RNA and sg-N RNA (Suppl ...
-
bioRxiv - Neuroscience 2022Quote: ... One µg of total RNA was reverse-transcribed using the iScript cDNA Synthesis Kit (BioRad). qRT-PCR was performed using the LightCycler480 SYBRGreen I Master1 kit (Roche Life Science ...
-
bioRxiv - Cancer Biology 2023Quote: ... One μg of total RNA was reverse transcribed using iScript cDNA synthesis kit (Bio-Rad). The relative expression of UCP1 ...
-
bioRxiv - Microbiology 2023Quote: ... One µg of RNA was converted into cDNA using iScript Reverse Transcription Supermix (Bio-Rad), and then cDNA was used for qPCR with iTaq Universal SYBR Green Supermix ...
-
pADP-ribosylation Regulates the Cytoplasmic Localization, Cleavage and Pro-apoptotic Function of HuRbioRxiv - Cell Biology 2023Quote: ... One microgram of total RNA was reverse transcribed using the 5X iScript reagent (Bio-Rad) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... One microgram of RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Plant Biology 2023Quote: ... The number of callose depositions was determined with Quantity One Colony Counting software (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... RNA was serially diluted and quantified using the One-Step RT-ddPCR system (Bio-Rad). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... incubated for one hour with horse radish peroxidase (HRP)-conjugated secondary antibodies (anti-mouse: Biorad, 172- 1011 ...
-
bioRxiv - Plant Biology 2024Quote: ... one μg total RNA was reverse-transcribed with the iScript cDNA synthesis kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... These lysates were then used with the iTaq Universal SYBR Green One-Step Kit (BioRad) for RT-qPCR in the BioRad CFX96 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Plant Biology 2021Quote: ... The IEF was performed on the 7cm length gel strips with immobilized pH gradients 3-10 and 3-6 (BioRad). After IEF ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Biochemistry 2019Quote: ... supplemented with 0.02% pI 3-10 ampholites (BioRad). Isoelectric focusing was performed in a Protean™ IEF cell (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The free and bound RNA bands were quantified using Quantity One software (Bio-Rad, Hercules, CA) and fit with the Hill equation in Prism.
-
bioRxiv - Biophysics 2019Quote: ... and quantitated by densitometry using a DNA standard curve and Quantity One® software (Bio-Rad).
-
bioRxiv - Biochemistry 2021Quote: ... Quantification of the images was performed using Quantity one and Gel doc XR from Biorad (Hercules).
-
bioRxiv - Neuroscience 2021Quote: ... Immunoblots were quantified by densitometric analysis of the fluorograms (Quantity One software; Bio-Rad, Hercules, CA) obtained in the linear range of the emulsion response.
-
bioRxiv - Microbiology 2021Quote: ... Multiplex RT-qPCR assay were carried out using Reliance One-Step Multiplex RT-qPCR Supermix (BioRad) or LightCycler Multiplex RNA Virus Master (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... Mixes were prepared according to the manufacturer’s instructions (iTaq Universal SYBR green One-Step kit, BioRad) with 1µL of RNA and a final concentration of 0.3µM of each primer.
-
bioRxiv - Microbiology 2021Quote: ... 2.5 ul of RNA was amplified using the iTaq Universal SYBR Green One Step kit (Biorad) and the following primers (SD29629:AGAAAACGCCGGTAGCAGAA and SD30197:CCTTCCCGAGCCTTCAACAT ...
-
bioRxiv - Molecular Biology 2020Quote: ... PCR products were quantified by densitometry analysis using the Bio-Rad Quantity One software (Bio-Rad). Fragments were pooled in an equimolar ratio ...
-
bioRxiv - Cancer Biology 2021Quote: ... Colony counting was performed using a Gel Doc Documentation System and Quantity One software (Bio-Rad) and quantification using Excel software.
-
bioRxiv - Cell Biology 2021Quote: ... Immunoblots in the linear range of detection were quantified using Quantity One software (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative PCR was performed using the iScript one step RT-PCR SYBR green kit (Bio-Rad). RT-qPCR was performed in duplicate for each of three independent biological replicates ...
-
bioRxiv - Synthetic Biology 2022Quote: The qRT-PCR reaction was conducted using the iTaq Universeral Probes one-step kit (Bio-Rad) supplemented with SybrGreen I nucleic acid stain (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Densitometric analysis was performed using Bio-Rad Quantity One software version 4.3.0 (Bio-Rad Laboratories, Inc.).
-
bioRxiv - Neuroscience 2020Quote: ... and protein immunoreactive bands quantified (Quantity One densitometry software or Image Lab software from Bio-Rad). WB data is presented as fold-increases of a control condition (stated in figure caption) ...