Labshake search
Citations for Bio-Rad :
101 - 150 of 1009 citations for 5α CHOLESTAN 3 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and quantified by The Quantity One software v4.6.3 (Bio-Rad). Optical density values for target proteins were normalized to Ponceau staining of the nitrocellulose membrane as loading control ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (36) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The signals were quantified using Quantity One software (Bio-Rad), and normalized to the last sample (set as 1) ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RTqPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid 41 ...
-
bioRxiv - Bioengineering 2022Quote: iTaq Universal Probes One-Step Kit (Biorad, cat. no. 1725141)
-
bioRxiv - Developmental Biology 2022Quote: ... Expression was evaluated by Quantity One® (v4.6.7, Bio-Rad) densitometry to adjust for equal amounts of expression using WCL of untransfected cells to maintain total protein content ...
-
bioRxiv - Immunology 2022Quote: ... the iTaq Universal Sybr green One-step kit (Bio-Rad) was used ...
-
bioRxiv - Molecular Biology 2022Quote: ... and analyzed with Quantity One 1-D software (Bio-Rad).
-
bioRxiv - Molecular Biology 2022Quote: ... or a QX ONE Droplet Digital PCR System (Bio-Rad) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2023Quote: ... controlled by The Quantity One software v 4.6.9 (Bio-Rad). For quantitative purposes ...
-
bioRxiv - Microbiology 2023Quote: ... The gel was activated using one-minute setting (Bio-Rad Imager ...
-
bioRxiv - Cell Biology 2023Quote: ... Band intensity was measured using Quantity One software (Bio-Rad). Quantitative ratios were calculated based on the data and are presented as relative values.
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2020Quote: ... CHAPS (3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate) were purchased from Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and films were scanned and analysed using Quantity One (Bio-Rad).
-
bioRxiv - Molecular Biology 2021Quote: ... iTaq Universal SYBR Green One-step kit (Bio-Rad, Hercules, CA) with DENV-2 specific primers and following a standard protocol (S1 Table ...
-
bioRxiv - Neuroscience 2019Quote: ... and non-saturating signals were quantified using Quantity One software (BioRad).
-
bioRxiv - Neuroscience 2020Quote: ... Densitometry analysis was performed using the Quantity One software (Bio-Rad).
-
bioRxiv - Bioengineering 2020Quote: ... both using the iTaq universal SYBR green one-step kit (BioRad). For 1-step RT-qPCR ...
-
bioRxiv - Bioengineering 2020Quote: ... and the data were analyzed using Quantity One (Bio-Rad, USA).
-
bioRxiv - Bioengineering 2020Quote: ... and the data were analyzed using Quantity One (Bio-Rad, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... and were imaged using Quantity One Version 4.6 software (BioRad, U.K.).
-
bioRxiv - Molecular Biology 2022Quote: ... in combination with Quantity One software (Version 4.6.3. Bio-Rad Laboratories). Based on both total protein measurement and WB images of APOA1 ...
-
bioRxiv - Immunology 2022Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (72) ...
-
β-catenin signaling via astrocyte-encoded TCF7L2 regulates neuronal excitability and social behaviorbioRxiv - Neuroscience 2020Quote: ... Densitometric analyses were performed using Quantity One 1-D software (BioRad).
-
bioRxiv - Cell Biology 2020Quote: ... iTaq Universal SYBR Green One Step Kit (Bio-Rad, Cat#1725150) was used to carry out one-step qRT-PCR and reactions were performed using 300ng of RNA ...
-
bioRxiv - Microbiology 2020Quote: ... the One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad) was applied according to the supplier’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with primers and probes (Table S1 ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid16 ...
-
bioRxiv - Cell Biology 2021Quote: ... MMP2/9 secretion was quantified using Quantity One Software (Bio-Rad).
-
bioRxiv - Microbiology 2020Quote: ... Blots were analyzed using Quantity One software (Bio-Rad, California, USA).
-
bioRxiv - Microbiology 2021Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid59 ...
-
bioRxiv - Plant Biology 2020Quote: ... and radioactivity counts were analyzed using Quantity One software (Bio-Rad). Statistical analysis was performed using GraphPad Prism software.
-
bioRxiv - Cell Biology 2019Quote: ... Relative protein expression levels were determined using Quantity One (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... One-Step RT-ddPCR Advanced Kit for Probes (Bio-Rad Laboratories), and probes were prepared on a QX200 Droplet Generator (Bio-Rad Laboratories) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with primers and probes specific for SARS-CoV-2 ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid59 ...
-
bioRxiv - Immunology 2021Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (65) ...
-
bioRxiv - Microbiology 2021Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N1 primers and probes targeting the nucleocapsid (IDTDNA ...
-
bioRxiv - Immunology 2022Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (96) ...
-
bioRxiv - Cell Biology 2022Quote: ... The band intensities were calculated using software Quantity One (Bio-Rad).
-
bioRxiv - Microbiology 2022Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (Boudewijns et al. ...
-
bioRxiv - Microbiology 2022Quote: ... using the iTaq Universal Probes One-Step RT-qPCR kit (BioRad) with N2 primers and probes targeting the nucleocapsid (20) ...
-
bioRxiv - Cancer Biology 2023Quote: ... One gel was allocated for Coomassie blue staining (Bio-Rad 1610803), in which gels were stained for 45 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Band intensities were quantified using Quantity One® software (Bio-Rad).
-
bioRxiv - Neuroscience 2023Quote: ... Quantification of Western blots was done with Quantity ONE 4.6.8 (BioRad) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... The latter one in 1x of commercially available transfer buffer (BioRad) onto a nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... Densitometric quantification was done using the Quantity One software (Bio-Rad) and Image studio lite version 5.2 (Licor ...
-
bioRxiv - Biochemistry 2023Quote: ... and quantified using Quantity One software (Bio-Rad Laboratories, Hercules, CA). The extent of plasmid DNA cleavage (Θ ...