Labshake search
Citations for Bio-Rad :
401 - 450 of 9175 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... diluted 2:1 in 4X Laemmli sample buffer (Bio-Rad) containing 100 mM Dithiothreitol (CAS No ...
-
bioRxiv - Microbiology 2023Quote: ... and β-tubulin (clone YL1/2, Bio-Rad; 1:5000) antibodies at 4°C overnight ...
-
bioRxiv - Microbiology 2022Quote: ... Capacitors were 1-cm Tygon tubing (2 mm ID, BioRad), having Luer connectors on each extremity ...
-
bioRxiv - Molecular Biology 2020Quote: ... IB analysis was performed after 6-7.5% SDS-PAGE or 4-20% Mini-PROTEAN TGX Precast Protein Gels (BioRad, Hercules, CA), with overnight incubation with a 1:1000 dilution of primary antibody and followed by a 1:5000 dilution of horseradish peroxidase-conjugated anti-rabbit or anti-mouse antibody (Jackson ImmunoResearch ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: 2-10ug of RNA extractions were loaded into a 5% acrylamide (Bio-Rad Laboratories: 1610156), 0.5x TBE (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 5% w/v of SM-2 Biobeads (BioRad, 152-8920), cleaned with 2% TX-114 for 2 h and regenerated with 30 CV of methanol ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... 4× Laemmli sample loading buffer (BioRad) was added to the supernatant and the mixture was boiled for 5 mins at 95 °C ...
-
bioRxiv - Microbiology 2024Quote: ... or 4-20% gradient gels (BioRad). Coomassie blue was used to stain gels with recombinant proteins ...
-
bioRxiv - Genetics 2024Quote: ... 4×Laemmli Sample Buffer (Bio-Rad) was added to lysates and samples were denatured at 50°C for 15min (and not boiled to prevent the aggregation of the DMT1 transmembrane protein) ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were transferred to a nitrocellulose membrane using the iBlot 2 device and membranes were blocked for 1 hour at RT in 5% (w/v) Blotting Grade Blocker/PBS (Biorad, #170-6404). GCase was detected using rb mAb to hGBA antibody (abcam ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1 h at 4°C in a sealed gravity column (Bio-Rad). The beads on the gravity column were washed with 50 ml of high-salt wash buffer (20 mM HEPES ...
-
bioRxiv - Molecular Biology 2022Quote: ... (2) post-AP beads were washed twice in 500μl 2% SDS wash buffer (2% v/v SDS (BioRad, #1610418), 150mM NaCl ...
-
bioRxiv - Genomics 2021Quote: ... The proteins were separated in the first dimension on 4-7 and 5-8 IPG strips (Bio-Rad). The strips were then loaded onto 8-20% gradient PAGE for separation on the second dimension ...
-
bioRxiv - Microbiology 2020Quote: ... The membranes were incubated overnight at 4°C in blocking solution 5% (w/v) Blotting-Grade Blocker (BioRad) in PBS-Tween buffer (1× PBS ...
-
bioRxiv - Cell Biology 2022Quote: Equal volumes (5 µg) of the prepared co-IPs were separated by SDS-PAGE (4–15%, Bio-Rad) and transferred to PVDF membranes (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... incubated 5 min at 95 °C and separated on gradient gels (BioRad 4-12% TGX pre-cast gels). The modified proteins could be detected with an infrared imager (Odyssey ...
-
bioRxiv - Neuroscience 2023Quote: ... with 5% β-Mercaptoethanol then loaded on 4-20% Criterion TGX Precast Midi protein gels (Bio-Rad #5671094). The gels were run in TGS buffer (1x ...
-
bioRxiv - Biochemistry 2024Quote: ... boiled for 5 min and then resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Biophysics 2024Quote: ... the solution was heated and slowly cooled from 80°C to 4°C (ramp rate of -1°C per 5 s) in a standard thermocycler (Bio-Rad CFX96 Real-Time System) prior to each experiment.
-
bioRxiv - Systems Biology 2020Quote: Plates were incubated for 2-3 days at 30 °C and imaged using a ChemiDoc MP (BioRad). Individual colonies from the plates generated to enable high second stress survival quantitation were counted using in-house developed MATLAB scripts ...
-
bioRxiv - Microbiology 2020Quote: ... or 500 ng to 3 µg for integrative plasmids (MicroPulserTM electroporator Biorad in 2 mm cuvettes (Eurogentec) at 25 µF ...
-
bioRxiv - Systems Biology 2023Quote: ... Time points were measured every 2-3 days by flow cytometry analysis of >10,000 cells (BioRad ZE5). For experiment with BRM014 (MedChemExpress #HY-119374) ...
-
bioRxiv - Biophysics 2022Quote: ... Acrylamide/Bis-acrylamide (30%, 29:1, 1610156, Bio-Rad), N,N,N’,N’-Tetramethylethylenediamine (TEMED ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... boiled for 5 min and separated on TGX Criterion Bis-Tris acrylamide gels (BioRad). Proteins were then transferred to a nitrocellulose membrane (BioRad) ...
-
bioRxiv - Plant Biology 2021Quote: ... plants were irradiated with UV-B lamps using fixtures mounted 30 cm above the plants (2 W m−2 UV-B and 0.6 W m−2 UV-A, Bio-Rad ChemiDoc™XRS UV-B lamps ...
-
bioRxiv - Developmental Biology 2021Quote: ... Additional pre-absorption controls were performed in which the anti-IL-6 antibody was incubated overnight at 4 °C with a 10 fold molar excess of recombinant chicken IL-6 (1.67 μM; Bio-Rad Laboratories, Inc.) before immunolabeling fixed sections of chick ocular tissues ...
-
bioRxiv - Genomics 2023Quote: ... The nuclei were isolated from cell homogenate by centrifugation and counted on an automated cell counter (TC20 BioRad, range 4-6 um). Transposition of 100k (weeks 1 ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were run on a low constant voltage at 4°C for 6 to 8 h in Tris Tricine SDS Running Buffer (Bio-Rad, USA). The peptides were detected by Instant Blue (Expedeon Inc.) ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were run on a low constant voltage at 4°C for 6 to 8 h in Tris Tricine SDS Running Buffer (Bio-Rad, USA). The peptides were detected by Instant Blue (Expedeon Inc.) ...
-
bioRxiv - Genetics 2021Quote: ... unspecific binding sites were blocked over night at 4°C with 3% milk powder (Marvel) in Tris Buffered Saline solution (BioRad) including 1% Tween 20 (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... and 3 mg bromophenol blue) and separated by SDS-PAGE using 4-to-20% gradient polyacrylamide gels (Bio-Rad Laboratories) at 10 mAmps for 16 h ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 3 and 10 μg of total protein were loaded on to a 4-15% gradient TGX gel (Bio-Rad) and transferred on to a PVDF membrane (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The protein-bound Ubiquitin-Trap Agarose were washed three times in the NP40 lysis buffer by centrifugation at 1,000 rcf for 3 min and resuspended in 4× Laemmli sample buffer (Bio-Rad), heat denatured ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-8 µL of samples and 3 µL of Precision Plus Protein Dual Color Standard (cat. no. 1610374, Bio-Rad) were run on 4-12% Bis-Tris Bolt gels (Thermo Fisher ...
-
bioRxiv - Plant Biology 2022Quote: ... approximately 60-70 μg of protein was loaded onto 7 cm pH 3-10 NL and pH 4-7 IPG strips (BioRad) and subjected to first-dimensional electrophoresis with increasing voltages from 50V to 2000V ...
-
bioRxiv - Molecular Biology 2020Quote: ... The mixture was then treated with 5% volume of Bio-Bead SM-2 resin (Bio-Rad) with shaking on ice for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 2% SDS (Bio-Rad), 10% glycerol (Sigma) ...