Labshake search
Citations for Bio-Rad :
351 - 400 of 9175 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 30µg of protein homogenates were separated by SDS-PAGE on a 4-12% gradient Bis-Tris gel (Bio-Rad, Hercules, CA, Criterion XT 3450125) in XT MES buffer (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... Lysates were diluted 1:1 with 2× Laemmli buffer (Bio-Rad) supplemented with 54 mg ml-1 DTT ...
-
bioRxiv - Microbiology 2024Quote: ... Approximately 2-5 µg of the non-denatured protein samples were diluted 1:1 with the native sample buffer (BIO-RAD #161-0738) and loaded into the polymerized gel ...
-
bioRxiv - Bioengineering 2024Quote: ... and interleukin 4 (IL-4)) cytokines run on a Bio-Plex 200 reader (BioRad). Data was collected from only two donors for RANTES ...
-
bioRxiv - Cell Biology 2020Quote: ... then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Genetics 2022Quote: ... boiled for 5 minutes and resolved on 4 to 20% TGX mini protean gels (Bio-Rad). The proteins were transferred to PVDF membranes using BioRad Trans-Blot semi-dry transfer ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg of sample were loaded on a 4-to-20% SDS polyacrylamide gel (Bio-Rad). Membranes were blocked for 3 hours in 5% milk in TBS (50 mM Trizma base and 150 mM NaCl ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl aliquots were separated on 4–20 % Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad) and stained with Instant Blue (Expedeon) ...
-
bioRxiv - Immunology 2024Quote: ... followed by centrifugation for 5 minutes at 12,000 rpm at 4°C (Bio-Rad, Hercules, CA). After centrifugation ...
-
bioRxiv - Cell Biology 2024Quote: ... then heated at 95°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... Digested DNA was purified and 2–5 μg of DNA was run on a 1% PFGE agarose gel (Bio-Rad) in 0.5 × TBE buffer using the CHEF-DRII system (Bio-Rad ...
-
bioRxiv - Genomics 2023Quote: ... 3-2) Protein Enrichment: The serum samples were processed with a ProteoMiner kit (Bio-Rad) and the protein concentration was determined using the BCA and fluorescence assays ...
-
bioRxiv - Neuroscience 2024Quote: ... solubilisates were incubated for 2 hours with 3 µg of coupled ABs (V5, BioRad, #MCA1360) or 40 µl anti-FLAG affinity resin (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-tubulin YL1/2 (dilution 1:50; Biorad) and guinea-pig anti-Ana1 (dilution 1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4–20% gel (Bio-Rad) using SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.8 × 4 cm (Bio-Rad). The column was washed with 10 column volumes (c.v. ...
-
bioRxiv - Cell Biology 2020Quote: ... 4-20% TGX gels (BioRad) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... 4-20% gradient (Bio-Rad,); and then proteins were transferred to PVDF membranes ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-15% (Bio-Rad #4561085), with 1X Tris/Glycine/SDS Buffer (Bio-Rad #1610732) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 4-12% acrylamide gels (BioRad) were loaded with protein samples ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3 μg of protein was separated on 4% to 20% precast polyacrylamide gels (Bio-Rad, cat # 4561095) for detection of histone H3 andH3K27me3 ...
-
bioRxiv - Molecular Biology 2023Quote: 4–8 μl of samples and 3 μl of Precision Plus Protein Dual Color Standard (1610374, Bio-Rad) were loaded into 4–12% Bis-Tris Bolt gels (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were blocked overnight at 4°C in PBS with 3% BSA and 10% donkey serum (Bio-Rad), stained with DAPI (ThermoFisher ...
-
bioRxiv - Plant Biology 2023Quote: ... Each reaction contained 5 μL of 2 x iQ SYBR Green supermix (Bio-Rad), 2 μL of diluted cDNA (10 times dilution for shoots and roots ...
-
bioRxiv - Plant Biology 2020Quote: ... The mixture was kept for 5 min at 95°C and 5 min on ice before loading on a TGX 4-20% Strainfree (Bio-Rad US) gel immersed in TGS 1X buffer ...
-
bioRxiv - Systems Biology 2021Quote: ... and 6 μl for slow growing mutants with lower OD600) on Stain-Free gels (4-20%, CAT # 4568096, Bio-Rad, Tris/Glycine SDS Buffer (CAT # 161-0732 ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Cancer Biology 2020Quote: ... Lysates were run on 4–15% or 4-20% Mini-protean TGX gels (Bio-Rad) and transferred onto ImmobilonTM membranes (MilliporeSigma ...
-
bioRxiv - Systems Biology 2021Quote: ... Immunoprecipitated proteins (4 μl) were resolved on 4-20% Criterion Tris-HCl Precast gels (BioRad) and visualized by silver stain (Pierce Silver Stain Kit ...
-
bioRxiv - Microbiology 2024Quote: ... using precast 4-20 % polyacrylamide gels (4-20 % CriterionTM TGX BioRadTM, BIO-RAD, Hercules, USA).
-
bioRxiv - Neuroscience 2021Quote: ... with primers listed in Table 4-1 on a CFX96 system (BioRad). Thermocycler conditions were 95°C for 3 min followed by 40 cycles of 95°C for 10 sec and 55°C for 30 sec ...
-
bioRxiv - Cancer Biology 2022Quote: ... was added to a 1:4 mixture of Laemmli Sample Buffer (BioRad) and 2- Mercaptoethanol (BioRad ...
-
bioRxiv - Biochemistry 2020Quote: ... Biobeads SM-2 (Biorad; 2 g; prewashed in nanodisc buffer) were added ...
-
bioRxiv - Immunology 2022Quote: ... samples were mixed 1:1 with 2 x native sample buffer (BioRad) and loaded on a 4-20% precast protein gel (BioRad ...
-
bioRxiv - Immunology 2021Quote: Protein analysis was performed using Bioplex assays (27-Plex, CXCL-1-, CXCL-2-, CXCL-5-, CCL22-single plex) (Bio-Rad Laboratories) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... followed by washes at room temperature (1 x 15 min, 2 x 5 min) and incubation with HRP-conjugated secondary antibodies (Bio-Rad) for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: ... which then heated at 90°C for 5 min before loading onto 4-20% gel (Bio-Rad). Proteins were separated using running buffer (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: ... Denatured protein lysates (5 μg) were loaded in 4–20% Criterion TGX Precast Gels (Bio-Rad, 5678095) and transferred to Immobilon-FL PVDF membrane (0.45 μm pore ...
-
bioRxiv - Cancer Biology 2020Quote: ... and incubated overnight at 4°C with primary antibodies dissolved in 5% Blotting-Grade Blocker (Bio-Rad). All primary antibodies and dilutions used are listed in Supplementary Table STm.1 ...
-
β-amyloid−driven synaptic depression requires PDZ protein interaction at AMPA-receptor subunit GluA3bioRxiv - Neuroscience 2021Quote: ... boiled for 5 min and loaded on a 4-15% Criterion TGX Stain-Free precast gel (BioRad). Protein samples were transferred unto a PVDF membrane (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... All samples were acquired on a ZE5 5-laser or 4-laser cell analyzer (Bio-rad laboratories) and analyzed with FlowJo software (Tree Star) ...
-
bioRxiv - Genomics 2023Quote: ... 10% glycerol) containing 5% ß-mercaptoethanol before SDS-PAGE on a 4-15% polyacrylamide gel (Bio-Rad). Proteins were transferred onto a nitrocellulose membrane blocked with AdvanBlock-Chemi blocking solution (Advansta ...
-
bioRxiv - Biochemistry 2023Quote: mtHsp60V72I (10 μL of 5 μM monomer) was loaded on a 4-15% TGX gel (Bio-Rad), run for 30 min at 200 V ...
-
bioRxiv - Biochemistry 2024Quote: ... 5% beta-mercaptoethanol) and run on 4-20% mini-PROTEAN TGX precast polyacrylamide gels (Bio-Rad #4561096) in Tris-glycine-SDS running buffer ...
-
bioRxiv - Genomics 2020Quote: ... 2% CleanCut (BioRad) agarose was melted at 70°C then cooled to 50°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The beads were washed 3 times and then eluted using 2 × Laemmli Sample Buffer (Bio-Rad). The elution was subjected to SDS PAGE to run the sample into the lane ...
-
bioRxiv - Cancer Biology 2020Quote: ... qRT-PCR was performed with C-kit variant 1 forward primer 5’-CAACAAAGAGCAAATCCATCCC-3’ and reverse primer 5’-CATCACAATAATGCACATCATGCC-3’ with iQ SYBR Green supermix (BioRad, Hercules, CA, Cat No. 1708882). The PCR program was as follows ...
-
bioRxiv - Biochemistry 2021Quote: KirBac3.1 protein was buffer-exchanged to 200 mM ammonium acetate (pH=8.0) with 0.5% C8E4 (2×CMC) using a Biospin-6 column (BioRad). The protein sample was loaded into a gold coated needle prepared in-house and analysed on a modified Q-Exactive mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein was then cleaned 2-times on Micro Bio-Spin™ P-6 gel Columns (BioRad, #732-6221) where buffer was exchanged with phase separation buffer ...
-
bioRxiv - Immunology 2022Quote: ... then blocked for 1 to 3 hr at RT with 50 μL/well of blocking buffer: 2% Blotting Grade Blocker (Bio-Rad cat. # 1706404) and 2% heat-inactivated goat serum (Gibco ...