Labshake search
Citations for Bio-Rad :
3451 - 3500 of 7510 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1 μg was reverse transcribed using the iScript cDNA Synthesis kit (Bio-Rad). Real-time quantitative RT– PCR was performed on a LightCycler 2.0 apparatus (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using the Bradford Protein Assay kit (Bio-Rad, Hercules, CA). Proteins were separated by electrophoresis on 4-20% SDS-PAGE gels (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... iTaq™ Universal SYBR® Green Supermix kit (cat. #1725124, Bio-Rad Laboratories Ltd.) was used according to the manufacturer’s recommendation with cDNA (diluted 1:10∼20 ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad), followed by qPCR reactions using SYBR Select Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using an iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). iTaq Universal SYBR Green Supermixes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022). Copy numbers were calculated with a regression curve from control RNA transcript standards and normalization to per µg RNA in cortex or per ml CSF ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were assembled using the ddPCR Supermix for Probes (No dUTP) kit (BioRad). Each ddPCR reaction contained 1 µl cDNA and either Dbh and Tbp or Th and Tbp probes (250 nM each ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules CA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA quality was determined by a bioanalyzer (Biorad, RNA Stdsense kit, Hercules, CA, USA). The RNA was reverse transcribed to cDNA with a SuperScript IV VILO kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... MRNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). Q-PCR was performed on a CFX-Connect Real Time PCR Detection System using SYBR Green Master Mix reagent (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Complementary DNA was synthesized from RNA using an iScript cDNA Synthesis Kit (Bio-Rad). qPCR was run with PowerUP SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... The complementary DNA (cDNA) was prepared using iScript™ cDNA Synthesis Kit (Bio-rad) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of RNA was converted to cDNA using iScript cDNA synthesis kit (BioRad). For Taqman real-time PCR analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using the iScript Reverse Transcriptase Supermix kit (BioRad, Cat# 1708841) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was carried out using iScript RT Supermix (BioRad cDNA kit, cart#1708841) and iTaq Universal SYBY green Supermix kit (BioRad cat# 1725121 ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was reverse-transcribed by using iScript TM cDNA synthesis Kit (Bio-Rad) in a volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1000ng RNA was used for cDNA synthesis with the Iscript kit (Bio-Rad) as described previously (19).
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using the DC Protein Assay Kit II (#5000112, Bio-Rad). Proteins (20μg ...
-
bioRxiv - Biochemistry 2022Quote: ... The total protein level was estimated by using the Bradford assay kit (Bio-Rad). 30 µg of total cellular proteins from the individual samples were subjected to SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized per kit instructions (iScript cDNA Synthesis, Bio-Rad, Hercules, CA). All primers were from Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the bound proteins were detected with the ClarityTM Western ECL kit (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentrations were determined using DC Protein Assay Kit (Bio-Rad; Hercules, CA, USA). Proteins were separated by SDS-PAGE and were blotted onto an Amersham™ Protran® nitrocellulose membrane (Merck KGaA ...
-
bioRxiv - Microbiology 2023Quote: ... following either random priming or gene specific primers by iScript cDNA synthesis kit (BioRad). 20 μL of cDNA reaction is diluted 5 times before the quantitative PCR reaction ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted and transcribed to cDNA with a reverse transcription kit (Bio-Rad). Quantitative real-time PCR reactions were performed using SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... Generation of cDNA was performed using the iScript cDNA synthesis kit (BioRad cat# 1708890), reverse transcribing 1 μg of RNA per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted RNA was used for cDNA synthesis using iScript cDNA Synthesis kit (BIO-RAD) in accordance with manufacturer’s instruction ...
-
bioRxiv - Pathology 2023Quote: ... and cDNA synthesized from 1μg RNA with iScript cDNA synthesis kits (Bio-Rad 1708891). Quantitative PCR was performed using iQ SYBR Green super mix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were measured using the BCA protein assay kit (Bio-Rad Laboratories, Inc.). Electrophoresis was performed using 30 μg of protein lysates ...
-
bioRxiv - Physiology 2023Quote: ... and converted to cDNA using an iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). qPCR was performed on a Bio-Rad CFX96 qPCR Detection System using a reaction mix containing Bio-Rad 2x SYBR Green Master Mix ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from total RNA with the iScript cDNA synthesis kit (Bio-Rad) and qPCR was carried out with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Bioengineering 2023Quote: ... and cDNA was synthesized using iScript™ cDNA Synthesis Kit (#1706691, BioRad, CA, USA). RT-qPCR was performed using iQ™ SYBR green Supermix (#1708582 ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein concentrations were measured using a DC protein assay kit (Bio-Rad, Hercules, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA was converted to cDNA using iScript cDNA Synthesis Kit (Bio-Rad, Cat# 1708891) and qPCR was performed using SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: ... and cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA) and a ProFlex thermocycler (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... 1μg RNA was reverse transcribed using iScript Advanced cDNA Synthesis Kit (Bio-Rad, 1725073). Realtime PCR was run on the Bio-Rad CFX96 with KapaFast qPCR mix ...
-
bioRxiv - Microbiology 2023Quote: ... HRP-conjugates were visualized using the Clarity Western ECL Substrate kit (Bio-Rad #1705060S).
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a BCA protein assay kit (Bio-Rad, Hercules, CA). Aliquots containing 40 μg of proteins were resolved in 8% SDS-PAGE under reducing conditions and transferred to a nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 μg of RNA was converted to cDNA using iScript cDNA Synthesis kit (BioRad) according to manufacturer’s instructions and diluted 1:100 in water ...
-
bioRxiv - Physiology 2023Quote: ... and transferred onto nitrocellulose membrane (Trans-blot Turbo Transfer system and kit, Bio-Rad) followed by blocking with 3% milk for 30 minutes ...
-
bioRxiv - Plant Biology 2023Quote: ... 3μL of bead-bound mRNA was reverse transcribed using the iScript advanced kit (BioRad). qRT-PCR was performed using the primers qRT_apy7_5’_F ...
-
bioRxiv - Developmental Biology 2023Quote: ... RNA (1 μg) was reverse transcribed using the iScript cDNA Synthesis kit (BioRad 1708890). mRNA expression was detected using the Fast Start Essential Green DNA master mix (Roche 06924204001 ...