Labshake search
Citations for Bio-Rad :
3351 - 3400 of 7510 citations for Mouse Cell Surface Hyaluronidase CEMIP2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... RNAs were reversely transcribed to cDNA using the iScriptTM cDNA Synthesis Kit (Bio-Rad). To determine mRNA expression levels of murine env (AAO37244.2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentration of the lysates was determined using a protein assay kit (Bio-Rad) and were incubated on a rotating wheel with either specific antibodies crosslinked to magnetic beads (Dynabeads ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by cDNA preparation using the BioRad iScript cDNA Synthesis kit (BioRad; Cat #:1708891). cDNA was subsequently purified with AMPure XP beads (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2022Quote: ... The cDNA was prepared using the iScript cDNA synthesis kit (Bio-Rad, CA, USA). Semi-quantitative PCR was carried out using the specific primers (Supplementary Table 1 ...
-
The transcription factor RUNX2 drives the generation of human NK cells and promotes tissue residencybioRxiv - Immunology 2022Quote: ... cDNA was generated using the iScript Advanced cDNA generation kit (Bio-Rad, Hercules, CA) according to the manufacturer’s guidelines ...
-
bioRxiv - Immunology 2022Quote: ... cDNA synthesis was carried out using the iScript™ cDNA synthesis kit (Bio-Rad). PerfeCTa® SYBR® Green SuperMixMaster Mix (QuantaBio ...
-
bioRxiv - Cancer Biology 2022Quote: ... 500 µg RNA was reversely transcribed using iScript Select cDNA Synthesis kits (Bio-Rad). Quantitative PCR was performed using iTaq Universal SYBR Green Supermix ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was transcribed using the iScript™ Advanced cDNA Synthesis Kit (Bio-Rad, 1725038). qPCR reaction was run using SsoFast EvaGreen Supermix (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... Complementary DNA (cDNA) was produced with the iScript™ cDNA Synthesis Kit (Bio-Rad) following the manufacturer’s instructions and starting with 500 ng total RNA ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and converted into cDNA with the iScript gDNA Clear cDNA Synthesis Kit (Bio-Rad). RT-PCR was performed with RedTaq Polymerase (VWR ...
-
bioRxiv - Developmental Biology 2020Quote: ... cDNA was generated from 1μg RNA using iScript cDNA Synthesis Kit (Bio-Rad, 1708891). qPCR was carried out on a Roche LightCycler 480 (Roche ...
-
bioRxiv - Genetics 2020Quote: Proteins extracted from Drosophila were quantified with BCA Protein Assay kit (Biorad, CA, US), 20μg per sample were prepared with 4x Laemmli Sample Buffer added with β-mercaptoethanol (#1610747 and #1610710 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... for RNA-seq validation and iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA) for knockdown experiments ...
-
bioRxiv - Physiology 2020Quote: ... cDNA synthesis were then carried out with the iScript cDNA Synthesis Kit (Bio-Rad). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2020Quote: ... T7-tagged templates were generated with the iProof High-Fidelity PCR Kit (Bio-Rad) using sequences cloned into plasmids pIB (LacZ) ...
-
bioRxiv - Immunology 2020Quote: ... RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad, CA, USA). Gene expression levels were determined using a TaqMan expression assay ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA samples were reverse transcribed into cDNA using the iScript cDNA synthesis kit (BioRad). Primers were designed to result in a product spanning exons 4-6 of cdipt ...
-
bioRxiv - Developmental Biology 2020Quote: ... RNA samples were subjected to reverse transcription using iScript™ cDNA Synthesis Kit (BioRad) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and cDNA synthesis was achieved using iScript™ Advanced cDNA Synthesis Kit (Bio-Rad), according to the manufacturer’s instruction ...
-
bioRxiv - Pathology 2020Quote: ... RNA was then used for cDNA synthesis using the iScript cDNA synthesis kit (BioRad). cDNA templates were used for real-time quantitative PCR with KAPA SYBR Fast qPCR kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). End-point PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Genetics 2021Quote: ... cDNA was synthesized from total RNA using iScript Advanced cDNA Synthesis Kit (Bio-Rad). Genomic DNA and cDNA were then genotyped for rs17779352 using a custom Taqman genotyping assay for rs17779352 (ANCE9Z2 ...
-
bioRxiv - Pathology 2020Quote: ... The blots were developed using ECL immunochemical detection kit (Bio-Rad, Richmond, CA, USA) and densitometric analysis was conducted to quantify the Western blot immunoreactivity with a scanner and ImageQuant software (Amersham Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was purified with an Arum Total RNA mini kit (Bio-rad #732-6820). Reverse transcription was carried out using the iScript Advanced cDNA Synthesis kit (Bio-rad #1725037) ...
-
bioRxiv - Microbiology 2020Quote: ... Signals were visualised using the ECL kit (Clarity Western ECL, Bio-Rad, Hercules, California) as suggested by the manufacturer.
-
bioRxiv - Microbiology 2020Quote: ... the protein signals were detected using the ECL detection kit (Bio-Rad, California, USA). Blots were analyzed using Quantity One software (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: Luminex profiles utilized the Human Inflammation Panel 1 37-plex assay kit (Bio-Rad) per the manufacturer’s protocol using the laboratory multianalyte profiling system (MAGPIX ...
-
bioRxiv - Microbiology 2021Quote: ... RNA (1 mg total) was reverse transcribed using iScript cDNA Synthesis Kit (Bio-Rad) and diluted to 100 μl in ddH20 for subsequent qPCR ...
-
A family of contact-dependent nuclease effectors contain an exchangeable, species-identifying domainbioRxiv - Microbiology 2020Quote: ... and finally developed using Immun-Star HRP substrate kit (Bio-Rad Laboratories, Hercules, CA). Blots were visualized using a Chemidoc (Bio-Rad Laboratories ...
-
bioRxiv - Physiology 2020Quote: ... 500ng mRNA was used for cDNA synthesis using the iScript kit (Bio-Rad, 1708891). Quantitative PCR was performed in triplicate 25 μL reactions using 2X SYBR Green SuperMix (PerfeCTa ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was carried out using an iScript™ cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed using the iQ™ SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was visualized using the ECL Western Blotting Detection Kit (Bio-Rad, USA).
-
bioRxiv - Genomics 2021Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Microbiology 2021Quote: ... The autoradiography signals were visualized using ECL advance Western blotting detection kit (BioRad, USA).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using the iScript™ Reverse Transcription Supermix kit (Bio-Rad, #1708841).
-
bioRxiv - Physiology 2021Quote: ... Protein concentration in the lysates was estimated using Dc protein assay kit (Bio-Rad). The lysates (30 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... and retro-transcribed into cDNA by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad, Hercules, CA, USA) and primers listed in Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total protein of the samples was quantified using a Protein DC kit (Bio-Rad). β-Mercaptoethanol and loading dye was added to 125 µg of the samples ...
-
bioRxiv - Immunology 2020Quote: Reverse transcription of RNA was performed utilizing iScript cDNA Synthesis Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA was reverse transcribed (RT) using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Biorad PN170-8891) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Purified sfGFP was measured using a Quick Start Bradford Kit (BioRad, Hercules, CA, USA) in biological triplicate and technical triplicate.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated by using the Aurum total RNA mini kit (Bio-Rad) and treated with DNase (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were determined using the Bradford Protein Assay Kit (Bio-Rad, Hercules,CA). Equal amounts of protein were separated on 4-12% NuPAGE SDS gel (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total protein concentration was measured using a DC Protein Assay kit (Bio-Rad Laboratories) and 40μg of protein lysate per sample was loaded on 4-20% polyacrylamide gels (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... using iScript™ Reverse Transcription supermix for RT-qPCR kit (BIO-RAD Laboratories, USA) following manufacturer’s instructions at PCR conditions (priming at 25°C for 5min ...