Labshake search
Citations for Bio-Rad :
301 - 350 of 5509 citations for 6 Chloro 5 6 dihydroimidazo 1 5 a pyrido 3 2 e pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 150 mM NaCl and 1mM DTT using Micro Bio-SpinTM P-6 Gel Columns (Bio-Rad). Protein concentration was determined by NanoDrop ...
-
bioRxiv - Molecular Biology 2019Quote: ... While 6-FAM labelled constructs were directly visualized under UV in gel documentation system (Bio-Rad), unlabelled constructs were visualized after staining with ethidium bromide (EtBr).
-
bioRxiv - Biophysics 2019Quote: ... P-6 (7326221) and P-30 (7326223) Micro Bio-Spin columns were obtained from Bio-Rad.
-
bioRxiv - Biochemistry 2019Quote: ... The supernatant was collected and DTT was removed by a Bio-Spin 6 column (Bio-rad) which was pre-equilibrated with 50 mM NaPi ...
-
bioRxiv - Genetics 2021Quote: ... The free [γ-32P]ATP was removed by the use of Bio-Spin 6 column (Biorad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.03% (w/v) DDM) using a centrifugal buffer exchange device (Micro Bio-Spin 6, Bio-Rad) as previously described43 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Labeled antibodies were purified by size exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concertation using Nanodrop 2000 at 260 nm.
-
bioRxiv - Cell Biology 2022Quote: ... Following cleanup of the sgRNAs using Micro Bio-Spin 6 columns (#7326221; Bio-Rad, Hercules, CA) and quantification ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were passed through a Micro Bio-Spin 6 Chromatography column (Bio-Rad, Cat#7326222), sonicated ...
-
bioRxiv - Biophysics 2021Quote: ... Excess Sulfo-SMCC was removed three times by gel filtration (Micro BIO- SPIN P-6, Biorad), mixed with thiol-modified DNA oligonucleotide (CTCTCCTCTCCACCATATCCA ...
-
bioRxiv - Biochemistry 2021Quote: ... Bio-Scale Mini Bio-Gel P-6 desalting cartridge was obtained from Bio-Rad (Hercules, CA). All UV-Vis measurements were taken using Cary 100 Bio UV-Vis from Agilent (Santa Clara ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were separated on nondenaturated 6% polyacrylamide gels and imaged by ChemiDoc system (Bio-Rad).
-
bioRxiv - Physiology 2021Quote: ... Relative protein abundance (N=6-8) were quantified using the Image Lab software (version 6.0.1; BioRad) and normalized by the protein content in each lane.
-
bioRxiv - Biophysics 2021Quote: ... AM2 was exchanged into each of these detergent solutions using Bio-Spin 6 columns (Bio-Rad) and diluted to a final concentration of 50 µM (per monomer ...
-
bioRxiv - Cell Biology 2022Quote: ... Densitometric analysis of protein levels were performed using the Image Lab 6 Software (Bio-Rad Laboratories).
-
bioRxiv - Neuroscience 2022Quote: ... The cytokine levels were calculated by standard curve and analyzed using microplate manager 6 software (BioRad). Cytokines were measured with MSD plates and performed according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2023Quote: ... The Superose 6 column (24 mL bed volume) was calibrated using a commercial calibration kit (Biorad) containing thyroglobulin (670 kDa) ...
-
bioRxiv - Biochemistry 2022Quote: ... pH 6.0/7.4) +/-0.03% DDM using a centrifugal exchange device (Micro Bio-Spin 6, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Quantitation of fluorescent signal was performed using a Biorad Chemidoc system and ImageLab version 6 (Biorad).
-
bioRxiv - Biophysics 2023Quote: ... Viroporins were exchanged into each of these ammonium acetate solutions using BioSpin 6 columns (Bio-Rad) and diluted to a final protein concentration of 20 μM (per monomer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Labeled antibodies were purified by size-exclusion chromatography using Bio-Spin 6 columns (Bio-Rad, 7326200) followed by measurement of protein concentration using a NanoDrop 2000 at 280 nm.
-
bioRxiv - Biophysics 2024Quote: ... the DNA solution was passed through a Micro Bio-Spin 6 column (Bio-Rad, Hercules, CA). The concentrations of oligo and conjugated fluorophore were measured using a Nanodrop spectrophotometer ...
-
bioRxiv - Cell Biology 2020Quote: ... X-ray film (Figs 1-5) and the ChemiDoc MP Imaging System (Bio-Rad, cat#17001402) (Supplemental Fig 3).
-
bioRxiv - Microbiology 2019Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was applied at 1 ml/min to a 5 ml ceramic hydroxyapatite column (BioRad BioscaleTM) in the dialysis buffer ...
-
bioRxiv - Immunology 2021Quote: ... IL-6, TNF-α, IL-8, IP-10, MCP-1, MIP-1α, MIP-1β, IL-1RA, G-CSF and Eotaxin; Bio-Rad Laboratories Inc.) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... was run with a 1% agarose TBE gel over 24 hours (Initial switch 1 sec, final switch 25 sec, 6 volt/cm, 120° included angle, Chef III, Bio-Rad, Hercules, CA, USA) with Midrange PFG and Lambda PFG markers (N0342S ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
bioRxiv - Physiology 2023Quote: ... Lysates were then incubated for 5 min at 37 °C and 5 min at 75 °C in a thermocycler (T100, Bio-Rad), immediately followed by storage at -80 °C until further processing.
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were then diluted 1:10 and 2 µL of diluted cDNA were used for RT-qPCR along with 5 µL of iTaq universal SYBR mix (Bio-Rad), 1.5 µL of primers (1.5 µM mix of forward and reverse ...
-
bioRxiv - Microbiology 2019Quote: T1L virions (2×1012 particles/ml) were incubated for 5 min at 55°C in a S1000 thermal cycler (Bio-Rad). The total volume of the reaction was 30 μl in virus storage buffer (10 mM Tris ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were incubated with appropriate primary and secondary antibodies listed in Table 2 in 5% milk and developed using the Clarity Western enhanced chemiluminescence substrate system (1705060, Bio-Rad) in a Xograph Compact X5 processor ...
-
bioRxiv - Biochemistry 2021Quote: ... The clarified supernatant was filtered through a 0.4 μM filter to remove the insoluble fraction and supplemented with 30 mM Imidazole pH 7.0 immediately before loading at a flow rate of 2 mL/min onto a 5 mL Ni-NTA immobilized metal affinity chromatography (IMAC) column (Bio-Rad) equilibrated in Buffer A (50 mM Tris-Cl ...
-
bioRxiv - Microbiology 2019Quote: ... or T1L/T3D M2 μ1 M258I σ3 S344P virions or ISVPs (2×1012 particles/ml) were incubated for 5 min at the indicated temperatures in a S1000 thermal cycler (Bio-Rad). The total volume of each reaction was 30 μl in virus storage buffer (10 mM Tris ...
-
bioRxiv - Neuroscience 2019Quote: ... 30 μg of each protein sample was denatured and reduced by boiling at 95°C for 5 min in 10% (v/v) 2-mercaptoethanol-containing Laemmli sample buffer (Bio-Rad). Samples were resolved by SDS-PAGE with a precast Tris-glycine gel (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... The beads were washed five times with IP lysis buffer and were boiled for 5-10 min in 2 times Laemmli sample buffer (#1610737, Bio-Rad) with 2-mercaptoethanol (#BP176-100 ...
-
bioRxiv - Immunology 2020Quote: ... in reducing or nonreducing conditions using SuperSep Ace 5%–20% gradient polyacrylamide gel (FUJIFILM Wako Pure Chemical, Osaka, Japan) and 2 × Laemmli Sample Buffer (Bio-Rad).