Labshake search
Citations for Bio-Rad :
151 - 200 of 5509 citations for 6 Chloro 5 6 dihydroimidazo 1 5 a pyrido 3 2 e pyrazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... 2 μl of gene-specific primer pair and 5 μl iTaq Universal SYBR Green Supermix (Bio-Rad). The relative transcript abundance of each gene (normalized to rpl4 ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 μl of diluted vRNP mixtures was loaded onto a 5% polyacrylamide native TBE gel (Bio-Rad) and run at 125 V for 80 min at 4°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... gossypii proteins) or TBS (S. cerevisiae proteins) supplemented with 1 mM DTT using pre-equilibrated BioSpin-6 spin columns (BioRad) or ...
-
bioRxiv - Microbiology 2022Quote: ... a desalting step was performed using micro Bio-Spin™ 6 (BIO-RAD) with 500mM ammonium acetate ...
-
bioRxiv - Immunology 2021Quote: ... followed by desalting using Micro Bio-spin 6 Chromatography Columns (Biorad, 732-6200). Then ...
-
bioRxiv - Immunology 2022Quote: ... using Iodogen reaction and then purified by P-6 spin column (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... using primers shown in Supplementary Table 6 and IQ SYBRGreen supermix (Bio-Rad). The relative standard curve method was used to calculate arbitrary gene expression using CFX-manager software (Bio-Rad) ...
-
bioRxiv - Biochemistry 2019Quote: ... bead supernatant was transferred to gel filtration column (Micro-Bio Spin 6, BioRad). Filtrate was added onto DNA Polymerase 1 (PolI ...
-
bioRxiv - Biochemistry 2021Quote: ... Excess MTS reagents were removed with Micro Bio-Spin 6 columns (Bio-Rad) equilibrated in crosslinking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were purified with Micro Bio-Spin P-6 columns (Bio-Rad Laboratories) according to manufacturer instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... adjusted using acetic acid) using size-exclusion spin columns (MicroBioSpin-6; Bio-Rad); the final concentration of AT was 10 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... The labeled antibodies are purified by P-6 Micro Bio-Spin Columns (BioRad).
-
bioRxiv - Cell Biology 2024Quote: ... PCR reactions were performed with Applied Biosystems QuantStudio 6 Flex using Sybrgreen (Biorad). Assays were performed in duplicate ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were buffer-exchanged using Micro Bio-Spin 6 desalting column (Bio-Rad) into 200mM ammonium acetate (pH adjusted to 7.4 with ammonium hydroxide) ...
-
bioRxiv - Neuroscience 2019Quote: ... After being blocked with TBST (1%) containing 5% blotting-grade blocker (Bio-Rad), the membranes were incubated overnight with primary antibodies against target molecules at 4 °C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Membranes were blocked in 5% nonfat dry milk for 1 hour (Bio-Rad) and incubated gently shaking overnight at 4°C in 1° antibody/PBS-T ...
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 1 h with 5% non-fat milk (Bio-Rad Laboratories) or BSA (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked for 1 h with 5% nonfat milk powder (Bio-Rad) in TBS + 0.05% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% Tween]) or for 5 min in EveryBlot blocking buffer (Bio-Rad, #12010020) before proceeding to primary and HRP secondary antibody staining in the respective blocking buffers ...
-
bioRxiv - Microbiology 2023Quote: ... sheep polyclonal anti-GFP (Bio-Rad, 4745-1051, 1:1000, 5 µg/mL), and rabbit polyclonal anti-GFP (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... TGF-β1 (5 ng/mL, BioRad), or a combination of DEX (10-6M ...
-
bioRxiv - Genomics 2022Quote: ... 5% Blotting-Grade Blocker (BioRad, 1706404)) for 1 h at RT ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% TBE-Urea gel (BioRad) was pre-run at 200 V for 15 minutes in 1X TBE buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... blocked in 5% skim milk (Biorad) and incubated with primary goat anti-GST (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μL of SYBR green (BioRad) and 0.25 μL of forward and reverse primers each were mixed with 1 μL of cDNA ...
-
bioRxiv - Microbiology 2024Quote: ... with 5% B-mercaptoethanol (Bio-Rad) was then added to the cell lysates and subsequently heated at 95°C for 5min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... antigen retrieval was performed in trypsin (pH 7.8) or 10 mM sodium citrate buffer (pH 6) and then incubated with F4/80 antibody (1:50; MCA497, Bio-Rad) or UCP-1 antibody (1:500 ...
-
bioRxiv - Microbiology 2019Quote: ... The libraries were quantified and checked for amplifiable adapters using the Library Quantification DNA standards 1-6 (Kappa Biosystems, Wilmington, USA) with the SsoFast EvaGreen qPCR supermix (Bio-Rad) using 10 μL EvaGreen master mix ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described 58 and a custom Bio-Rad 6-plex based on the Human Inflammation Panel 1 (BioRad, Cat# 171AL001M). For both assays ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by vertical gel electrophoresis on a 6% (60:1 Acrylamide/Bisacrylamide) native gel column using a 491 Prep Cell (Bio-rad) run at 10W and 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 2 μl of the cDNA sample were supplemented with 5 μL of SsoADV Universal SYBR Green Supermix (BioRad) mix 2X ...
-
bioRxiv - Molecular Biology 2024Quote: ... C) 5’-CTTCAAGGAGGACTGCCAC & and 5’-TGGGGTAGGTGCCGAAGT) and target concentration was determined using QuantaSoft Software™ (Bio-Rad).
-
bioRxiv - Cell Biology 2020Quote: ... at 100V for 1 hour and blocked for 1 hour with 5% non-fat milk (Bio-Rad) before incubation at 4 C overnight with appropriate primary antibodies ...
-
bioRxiv - Immunology 2024Quote: ... blocked with 5% FBS for 1 hour and incubated with anti TGN46 antibody (#AHP500GT, BioRad, 1:2000) at 4°C overnight ...
-
Comparative regulomics reveals pervasive selection on gene dosage following whole genome duplicationbioRxiv - Evolutionary Biology 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were counted on an automated cell counter (TC20 BioRad, range 4-6 um) and further confirmed intact under microscope ...
-
bioRxiv - Microbiology 2020Quote: ... un-conjugated dye was removed using a Micro Bio-Spin P-6 column (BioRad) at 1000 x g ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was purified on a Bio-Spin® P-6 Gel Columns (BioRad) desalting column equilibrated in BC-0 buffer to separate labeled protein from excess fluorophore and then stored at −80 °C ...
-
bioRxiv - Biophysics 2021Quote: ... and subsequently purified using Micro Bio-Spin P-6 gel columns (Bio-Rad 7326221). The BG-oligos were then conjugated to SNAP-proteins by mixing at a 2:1 molar ratio in storage buffer (20 mM HEPES [pH 7.5] ...
-
bioRxiv - Molecular Biology 2019Quote: ... Gel exclusion chromatography on Bio-Gel P-6 acrylamide resin (Bio-Rad #150-0740) in renaturation and storage buffer RN#5 (0.1 M NaH2PO4 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 6-well plates were imaged using a chemidoc (Bio-Rad, Hercules, CA, USA) and the number of colonies was counted in CellProfiler using an automated analysis pipeline ...
-
bioRxiv - Neuroscience 2020Quote: ... Neurons at DIV 4-6 were transfected using a biolistic gene gun (Bio-Rad) and were assayed 3 days after transfection as described previously (5,6,26,27) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Products were resolved via 6% PAGE and imaged using a ChemiDoc XRS (Bio-Rad). The percent spliced in (PSI ...