Labshake search
Citations for Bio-Rad :
3151 - 3200 of 7302 citations for Superoxide Anion Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Cytokine concentrations in serum were determined by a magnetic bead-based multiplex assay using Luminex technology (BioRad), according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: Pancreatic protein was isolated as described (59) and quantified using a Bradford protein assay (Bio-Rad, #5000006). Isolated protein was resolved by SDS-PAGE and transferred to polyvinylidene fluoride membrane (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatant was transferred to fresh tubes and protein concentration was determined by Lowry assay (Bio-Rad, 5000113).
-
bioRxiv - Microbiology 2023Quote: ... Total protein concentration of purified DENV VLP was measured by Quick Start Bradford Protein Assay (Bio-Rad). Purity of the DENV VLP was assessed by SDS-PAGE followed by Coomassie dye-based staining using QC colloidal Coomassie stain (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cell debris was pelleted by microcentrifugation at 4°C and protein levels quantified using Bradford Assays (BioRad) as previously described (38) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration was determined using a colorimetric assay based on the Bradford dye-binding method (Bio-Rad Protein Assay Dye Reagent ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein concentration in the cell lysate was quantified using the Bradford protein assay (#500-0006, Bio-Rad). 30 μg of each sample was boiled with 4x Laemmli Sample Buffer containing 10% 2-mercaptoethanol (#1610747 ...
-
bioRxiv - Cell Biology 2023Quote: ... Supernatants were transferred to new tubes and total protein was quantified using a Bradford Assay (Bio-Rad). 20 µg protein per sample was reduced with 3 mM TCEP (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... The assays were carried out using CFX96 Touch Real-Time PCR System (Bio-Rad, Hercules, California, USA). After an initial denaturation at 95°C for 1 min ...
-
bioRxiv - Biochemistry 2023Quote: ... 3H-2DG uptake was subsequently adjusted for protein content using a detergent compatible (DC)-assay (Bio-Rad). The glucose-uptake experiment was repeated on three separate days with same observed effect ...
-
bioRxiv - Neuroscience 2024Quote: ... Reagents for SDS-polyacrylamide gel electrophoresis and Bradford protein assays were from Bio-Rad (Hercules, CA, USA), fetal bovine serum and enhanced chemiluminescence (ECL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Concentration of protein collected in the supernatant was determined using DC protein assay (5000113-5; Bio-Rad). Standard procedures were used for western blotting ...
-
bioRxiv - Biochemistry 2024Quote: ... Then the total protein concentration of each soluble fraction was measured by Lowry DC Protein Assay (BioRad). From each soluble fraction ...
-
bioRxiv - Biochemistry 2024Quote: ... Protein concentration was determined using Quick Start™ Bradford Protein Assay (Cat.# 5000201, Bio-Rad Hercules, CA).
-
bioRxiv - Microbiology 2024Quote: Cytokines from serum and lung homogenate were quantified using Bio-Plex mouse cytokine 23-plex assay (BioRad) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... Supernatants were collected and analyzed for protein concentration using the Bio-Rad Protein Assay Dye (Bio-Rad). 20-50 mg of protein was denatured at 95°C for 5 min in 5x SDS sample buffer (250 mM Tris-HCl pH 6.8 ...
-
bioRxiv - Plant Biology 2024Quote: ... The Supernatant was isolated and sample protein concentrations were calculated by Bradford assay (Bio-Rad Laboratories, 2010) using the Quick Start Bradford 1x Dye Reagent (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... Real-time PCR assays were performed using a CFX Connect Real-Time PCR Detection System (Bio-Rad). Target gene mRNA expression was quantified by real-time PCR using iTaq Universal SYBR Green Supermix (Applied Biosystems ...
-
bioRxiv - Microbiology 2024Quote: ... Protein concentrations were determined using the Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, Hercules, CA, USA). The purity was controlled by electrophoresing 3 µg of protein with SDS-sample buffer on a polyacrylamide gel (mPAGE™ 4-20% Bis-Tris Precast Gel ...
-
bioRxiv - Immunology 2021Quote: ... Western blots were detected using chemiluminescence detection kit (Pierce) or chemiluminescence kit (BioRad).
-
bioRxiv - Cell Biology 2023Quote: ... kits and cDNA was generated using iScript cDNA Synthesis kits (Bio-Rad #1708890) as per the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2023Quote: ... a reverse transcription kit (iScript select cDNA synthesis kit, Bio-Rad, Hercules, CA) was used to create cDNA from the total RNA with gene-specific antisense primers (Table S1) ...
-
bioRxiv - Physiology 2019Quote: ... RNA was isolated and cDNA was formed using commercial kits according to manufacturer’s instructions (NucleoSpin miRNAs kit; Macherey-Nagel, Düren, Germany; iScript cDNA synthesis kit, Bio-Rad, Veenendaal, Netherlands). Quantity and chemical purity of RNA and cDNA were assessed using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: Protein concentration was estimated using DC protein assay as mentioned in the manual (Bio-rad Inc., 500-0116). 100 μg of total protein was resolved on 10 ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentration of cell lysates was determined by using the 595 nm Protein Assay Dye Reagent (Bio-Rad). Western blots were carried out after 9% SDS-PAGE ...
-
bioRxiv - Cell Biology 2020Quote: ... Gaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatcggcactgcgtgcgccaattct gcagacaaatggcagtattcatccacaattttaaaagaaaagggggg (FAM) The house keeping probe used for comparison was EiF2C1 (Assay ID: dHsaCP2500349 Cat: 10031243, BioRad).
-
bioRxiv - Genetics 2021Quote: ... to perform the quantitative real-time PCR assay with CFX ConnectTM Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2021Quote: qPCR was performed using an EvaGreen (dye-based) assay on a CFX96 Touch Real-Time Thermocycler (Bio-Rad). Reactions were assembled using 2× SsoFast EvaGreen Master Mix (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Calcium levels were normalized to protein levels measured using the Bradford assay (Bio-Rad Laboratories, Hercules, CA, # 5000006).
-
bioRxiv - Molecular Biology 2020Quote: ... the supernatant removed to a new microcentrifuge tube and protein concentration determined using the Bradford assay (Bio-Rad).
-
bioRxiv - Bioengineering 2020Quote: Assay was performed on a real-time PCR instrument (CFX96 Real-Time PCR Detection System, Bio-Rad Laboratories). The raw fluorescence data were processed and the Cq values were extracted with the accompanying software (Bio-Rad CFX Manager 3.1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The resulting supernatant was isolated and protein quantification was carried out through Bradford assay per manufacturer instructions (Biorad). For SDS-PAGE ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein concentrations of whole cell extracts and tissue lysates were determined using a Bradford Protein assay (Bio-Rad). 50μg of sample proteins per well were subjected to SDS-PAGE and transferred to polyvinylidene fluoride (PVDF ...
-
bioRxiv - Neuroscience 2020Quote: ... The kinase assay was quenched by boiling samples at 98°C in Laemmli sample buffer (BioRad, 161-0737) for 5 min prior to western blot analysis.
-
bioRxiv - Microbiology 2021Quote: ... All qPCR assays were performed in Bio-Rad CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Neuroscience 2021Quote: ... using immune-assay Luminex technology (Bio-Plex X200 System equipped with a magnetic workstation, BioRad, Hercules, CA, USA). All samples were run undiluted ...
-
bioRxiv - Biophysics 2021Quote: The thermal shift assay was conducted in an iCycle iQ5 Real Time Detection System (Bio-Rad, Hercules, CA). A solution of total volume 20 μL containing 10 μM of the purified CcdB protein and 2.5X Sypro orange dye in suitable buffer (200 mM HEPES ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein concentration was quantified in triplicates using the DC™ Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The concentration of protein from each sample was measured with Bio-Rad protein assay (Bio-Rad, Hercules, CA), equalized ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein purity was analyzed via SDS-PAGE and protein concentration was measured using Bradford (Bio-Rad protein assay). GST-Rap2a Lysine mutants (K2R ...
-
bioRxiv - Biochemistry 2020Quote: ... the supernatants were kept and total protein concentrations were quantified by Bradford assay (Bio-Rad, Gladesville, NSW, Australia) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... Protein concentration in purified microsomes and RyR1 fractions was measured with Quick Start Bradford Protein Assay (Bio-Rad). The plasmid encoding for MSP1E3D1 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein concentrations of the thylakoid suspensions were determined with DC™ Protein Assay (Bio-Rad, Hercules, CA, USA). Thylakoids used in functional experiments were kept on ice in the dark and always used within a few hours of isolation.
-
bioRxiv - Microbiology 2020Quote: ... Nitrite concentrations were normalized to the protein levels of each sample by the Bradford assay (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2021Quote: ... 30µg of protein was used for western blot analysis after quantification using DC™ Protein Assay (BIO-RAD). For western-blot analysis of sucrose gradient derived samples ...
-
bioRxiv - Molecular Biology 2022Quote: ... The protein concentration was measured using the Protein Assay Dye Reagent Concentrate (Bio-Rad, Richmond, CA, United States) and all of the samples for each experiment were normalized to the same concentration ...
-
bioRxiv - Cell Biology 2022Quote: Total protein concentration of cell or liver lysate was determined using the Lowry assay (Bio-Rad Laboratories, 5000112JA). Equal amounts of protein were loaded onto Tris-glycine sodium dodecyl sulfate-polyacrylamide gels ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2×106 cells (extracted tissues or cell culture) were suspended in 50 μL RIPA (Radio ImmunoPrecipitaion Assay; BioRad) lysis buffer containing 200 mM PMSF (Alpha-Phenyl Methyl Sulfonyl Fluoride ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 μg/lane of total protein (determined in duplicate by Bio-Rad Protein Assay with BSA as standards) was loaded for control and WD samples ...
-
bioRxiv - Cancer Biology 2022Quote: Protein from lysed samples was quantified using the Bradford (Bradford, 1976) Protein Assay Dye Reagent (Bio-Rad, USA). Proteins were resolved by SDS-PAGE using 15% gels and transferred onto nitrocellulose membranes (Amersham Protran ...