Labshake search
Citations for Bio-Rad :
251 - 300 of 3318 citations for Recombinant Human Collagen Type II Alpha 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Goat F(ab)2 anti-human IgG: HRP (Biorad), Goat anti-mouse IgG (H/L) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... human cytokine 17 and 27-plex from Bio-Rad, (NSW ...
-
bioRxiv - Microbiology 2021Quote: ... were treated with 20% blocking buffer (Li-Cor Biosciences, Lincoln, US) followed by incubation with anti-His-tag mouse primary antibody (dilution1/5000, Bio-Rad) and revelation with a IRDye 800CW Goat anti-mouse IgG secondary antibody (dilution 1/10000 ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated with a secondary goat anti-rabbit (for the anti-YjbI antiserum) or goat anti–mouse (for the anti–His-tag antibody) antibody conjugated with horseradish peroxidase (Bio-Rad) for 2 h ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6× His-tag blots were washed with TMST and TSM and developed with the Clarity Western ECL kit (Bio-Rad) and imaged in a Gel-Doc system (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant protein purities were assessed by SDS-PAGE using 4-20% Mini-Protean TGX gels (Bio-Rad, #4561094) and quantified using the BCA Protein Estimation kit (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: IgE receptor cross-linking (IgECL) on HSMCs was accomplished through sensitization with 1 μg/mL chimeric human IgE anti-NP antibody (MCA333S, BIO-RAD, Hercules, CA) for 24 hours ...
-
bioRxiv - Bioengineering 2021Quote: Ramos B cells were retrovirally transduced with a construct encoding spike protein tagged with the fluorophore mScarlet at the C-terminus and sorted by FACS (Bio-Rad S3e Cell Sorter). For the experiment ...
-
bioRxiv - Plant Biology 2020Quote: ... Anti-SLR1 immunoblots were performed in a Mini-Protean II System (Biorad), using custom-made anti-SLR1 polyclonal specific antibody [1:5.000 ...
-
bioRxiv - Plant Biology 2020Quote: ... 400 Ω and 25 μF using a Gene Pulser II (Bio-Rad). The electroporated cells were immediately recovered in 800 μl SOC and incubated at 30°C for 90 min with vigorous shaking ...
-
bioRxiv - Microbiology 2021Quote: ... The purified fragment was electroporated (2.5kV, 25μF BioRad Gene Pulser®II) into 50 μL of ddH2O-washed BAC16-GS1783 E.coli ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 7.2) using Gene Pulser II (Bio-Rad Laboratories, Inc., Hercules, CA) under following conditions ...
-
bioRxiv - Cell Biology 2019Quote: ... elegans cells (eg. Bio-Rad TC20™ and Invitrogen Countess II™) were empirically found to be about an order of magnitude lower than the cell counts obtained using FACS ...
-
bioRxiv - Biochemistry 2021Quote: ... Pol II peak fractions after anion-exchange chromatography (UNO Q, Bio-Rad) were pooled before buffer exchange to Pol II buffer (25 mM Na-HEPES pH 7.5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... were used to perform six electroporation reactions on a MicroPulserTM II (BioRad) following the manufacturer’s instructions (pre-set EC1 setting with V ...
-
bioRxiv - Microbiology 2019Quote: ... Plugs were run using a CHEF-DR II PFGE system (Biorad, USA). For efficient separation of fragments ...
-
bioRxiv - Pathology 2020Quote: ... resolved on a 10% SDS-polyacrylamide gel (Mini-PROTEAN II, BIO-RAD) and then electrophoretically transferred to a polyvinylidene fluoride membrane (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... Transfections were performed using electroporation (Gene Pulser II, Bio-Rad; 350V, 1000µF) and post-transfected cells were selected with G418 (0.2 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Jurkat cells were transfected cells by electroporation (Gene Pulser II, Bio-Rad) and monoclonal cell lines were selected in Geneticin Selective Antibiotic (G418 Sulfate ...
-
bioRxiv - Microbiology 2022Quote: ... Protein concentration was determined with the Protein Assay Kit II (Bio-Rad), and 10-15 µg of protein was loaded into 12% acrylamide Criterion XT Bis-Tris Precast Gels (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... Parasite transfection was performed via electroporation using Gene Pulser II (Bio-Rad) at high capacity ...
-
bioRxiv - Genetics 2023Quote: ... Protein concentration was measured with DC Protein Assay kit II (BioRad, 5000112) against a BSA standard curve and measured with Synergy H4 microplate reader ...
-
bioRxiv - Cell Biology 2023Quote: ... DC Protein Assay Kit II (5000112) was purchased from BioRad (Hercules, CA). HaltTM Protease and Phosphatase Inhibitor (1861280) ...
-
bioRxiv - Microbiology 2023Quote: ... and subjected to electroporation using a Gene Pulser II electroporator (BIO-RAD) at 210V and 975μF ...
-
bioRxiv - Microbiology 2021Quote: ... the Pro™ Human Cytokine 27-plex Assay (Bio-Rad) was used according to the manufacturer’s protocol and read on a Bio-Plex 3D suspension array system including a Bio-Plex Manager software v 6.0 (Bio-Rad).
-
bioRxiv - Developmental Biology 2022Quote: ... or anti-Human IgG Kappa (STAR 127, Bio-Rad, USA) control antibody
-
bioRxiv - Microbiology 2022Quote: ... and HRP-conjugated goat anti-human IgG (BioRad #172-1050) were used as secondary antibodies for ELISA and western blot assays.
-
bioRxiv - Immunology 2019Quote: ... or RasGRP1 (PrimePCR SYBR Green Assay RasGRP1 human, Bio-Rad, amplicon context sequence GGTTCCTTGGTTCCCGGGCATAGGAAAGCTCATAGATTTCATCCTCAGTGTAGTAAAGAT CCAGGGATAACGTCAGCAAGTGTACCAAGTCCTTGTTAGCCTCCAAGG (exon 10) ...
-
bioRxiv - Molecular Biology 2022Quote: ... goat anti-human IgG F(ab’)2 (STAR126, Bio-Rad), anti-M13-pVIII-HRP (Cytiva 27-9421-01 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-human– horseradish peroxidase (HRP) secondary antibody (Bio-Rad) at a 1:3,000 dilution was applied for 1 h at 4°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Mouse monoclonal anti-Human Vinculin (V284) antibody (Bio-Rad, MCA465GA), 1:1,000 ...
-
bioRxiv - Immunology 2020Quote: Staining of 2×105 cells per well was performed with mouse anti-human CD79α (clone HM57, Bio-Rad AbD Serotec, Puchheim, Germany, 1:100) for identification of B cells and Alexa Fluor 647-conjugated rat anti-human CD3∊ (clone CD3-12 ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR was performed in 0.5 ml eppendorf-type microcentrifuge tubes on an iCycler (Bio-Rad, Hercules, CA, USA) or Dyad (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... The sample was passed twice on 2 x Mini CHT ™ type I column (Bio-Rad, United States). Elution was performed with a gradient of 0 to 200 mM NaPO42- in 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... acidified to pH3–4 by adding appropriate amount of TFA and subjected to HPLC purification using a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA). The S-sulfonated FAM237A was eluted from the C4 reverse-phase column by an acidic acetonitrile gradient composed of the acidic solvent A (0.1% aqueous TFA ...
-
bioRxiv - Biochemistry 2023Quote: ... and the S-sulfonated FAM237B was eluted from a C4 reverse-phase column (Hi-Pore reversed-phase column, 4.6 × 250 mm, Bio-Rad, Hercules, CA, USA) by an acidic acetonitrile gradient ...
-
bioRxiv - Microbiology 2024Quote: ... and HopAM1 and C-terminal Flag-tagged IpaH4 were generated by PCR amplification using primers containing Flag sequences and flanking SacII / PacI off pIB/V5-His templates using iProof DNA polymerase (Bio-Rad; Table S4) and cloned into the pDGOpIE2 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein concentration was determined using the DC Protein Assay Kit II (BioRad, 5000112) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cells were then counted using the countess II automated cell counter (Biorad), and the final number adjusted according to the number of wells used and the volume of resuspension.
-
bioRxiv - Biochemistry 2020Quote: ... aeruginosa strains were transformed by electroporation using a GenePulser II (BioRad, Hercules (CA), United States ...
-
bioRxiv - Microbiology 2021Quote: ... 25 mF using a Bio-Rad gene pulser II (Bio-Rad, X, USA). Directly after transformation 50 μl of a 2x concentrated recovery solution (1% sucrose ...
-
bioRxiv - Immunology 2022Quote: Protein from extracts was measured (BioRad DC™ Protein Assay Kit II #5000112) and equal amounts of protein were loaded into a 4-15% gradient polyacrylamide gel (BioRad TGX™ Precast Midi Protein Gel #5671085 ...
-
bioRxiv - Immunology 2022Quote: ... Protein concentration was assessed by the Bradford Assay (Biorad Protein Assay Kit II) and 25ug of cell lysates from each condition were resolved by 8% SDS-PAGE with NuPAGE electrophoresis system (Invitrogen/Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α using a Bio-Rad Gene Pulser II Electroporation system (Bio-Rad) with the following parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... Digested DNA was separated via CHEF electrophoresis (Bio-Rad, CHEF DR II System) at 3 V/Cm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... (ii) a quick DNA extraction was made using Chelex 100 by Bio-Rad, and the DNA was used to make a PCR using the primers and methodology developed by Leisova et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... Pulsed field gels were run using a CHEF-DR II apparatus (Bio-Rad) for 22h at a constant 45 V ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Electroporation was performed using a Gene Pulser II system (Bio-Rad, Hercules, CA) set at 25 µF ...
-
bioRxiv - Neuroscience 2024Quote: ... using a mini-gel apparatus (Bio-Rad Mini Protean II cell, Milano, Italy). Proteins were than electroblotted on Immuno PVDF membranes (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total protein was measured by DC™ Protein Assay Kit II (BIO-RAD). An equal amount of protein was resolved in NuPAGE™ 3 to 8% ...