Labshake search
Citations for Bio-Rad :
251 - 300 of 7089 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Systems Biology 2020Quote: ... Slides were washed with PBS (3 times, 3 min) and developed using the BCIP-NBT detection system (Bio-Rad Laboratories) for 12 min followed by washing with PBS (3 times ...
-
bioRxiv - Genomics 2020Quote: ... and 6 µL H2O were mixed and incubated in a thermocycler (BioRad) using the following program ...
-
bioRxiv - Microbiology 2021Quote: ... Unincorporated nucleotides were removed using Micro Bio-Spin 6 columns (Bio-rad) according to the manufacturers protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Unreacted free dye was removed using P-6 Gel Columns (Bio-Rad). The labeling efficiency is about 1 Alexa Fluor 647 dye per antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... Ethanol precipitation followed by P-6 Micro Bio-Spin Columns (Bio-Rad) were employed to remove unconjugated dyes.
-
bioRxiv - Genomics 2022Quote: ... purified on a Micro-Bio Spin P-6 Gel Column (Bio-Rad)and subsequently annealed to 5 µg of RNA extract ...
-
bioRxiv - Biochemistry 2024Quote: ... a calibration curve was created using Microplate Manager® 6 (Bio-Rad) to calculate the intracellular SAM concentration.
-
bioRxiv - Microbiology 2024Quote: ... All assays were desalted by Micro Bio-Spin 6 columns (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... Unincorporated nucleotides were removed by Micro Bio-Spin 6 columns (Bio-Rad) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... using two cycles of spin gel-filtration (MicroBioSpin P-6, Bio-Rad). The complex was subsequently diluted by 20 mM AA to 0.5 µM (estimated based on 3+3 stoichiometry) ...
-
bioRxiv - Microbiology 2023Quote: ... for up to 6 h and imaged with the ChemiDoc (Bio-Rad). Signal intensities were quantified in ImageLab (Bio-Rad).
-
bioRxiv - Cancer Biology 2023Quote: ... and a 6-Plex Mouse Cytokine Panel (Bio-Rad Laboratories; Hercules, California). Insulin-like growth factor 1 (IGF-1 ...
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad). The concentration of the protein was determined by using the absorption measured at 280 nm and the corresponding extinction coefficient of 20970 M-1cm-1.
-
bioRxiv - Biochemistry 2023Quote: ... or through a Mini Bio-Gel P-6 Desalting Cartridge (Bio-Rad).
-
bioRxiv - Biochemistry 2024Quote: ... Excess DTT was removed using Micro Bio-Spin 6 columns (Bio-Rad), which were prewashed with deionized water and then with 5 ml of 20 mM phosphate buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... After 3 washes with 0.05% tween20 (Bio-Rad) in TBS buffer (Bio-Rad) ...
-
bioRxiv - Pathology 2024Quote: ... non–linear 3-10 pH gradient (Bio-Rad), followed by SDS-PAGE separation on 8-16% polyacrylamide gradient midi gels (Criterion TGX gels ...
-
bioRxiv - Neuroscience 2021Quote: ... A 1:5 dilution from serum samples was combined with 4 °C Laemmli sample buffer (Bio-Rad Laboratories, Hercules, CA) and heated at 100 °C for 10 min before loading into 12% Mini-PROTEAN TGX Stain-Free gels (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and eIF2B4 loci were amplified with the primer pairs detailed in Table 4 and run on a 1% agarose gel and imaged using a ChemiDoc XRS+ imaging system (Biorad). The expected WT fragment length for the eIF2B1 ...
-
bioRxiv - Biophysics 2020Quote: ... samples were washed for two minutes with degassed polyacrylamide (PA) solution consisting of 4% (vol/vol) 19:1 acrylamide/bis-acrylamide (161010144, BioRad), 60 mM Tris-HCl pH 8 (AM9856 ...
-
bioRxiv - Microbiology 2022Quote: ... 7.5 mg of proteins was diluted in ChIP buffer supplemented with 0.01% SDS and precleared for 1 h at 4 °C with 50 μl of SureBeads Protein A Magnetic Beads (BioRad) and 100 μg bovine serum albumin (BSA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... was used at a dilution of 1:10000 for overnight at 4°C and probed for protein using ECL chemiluminescence kit (BioRad). HPLC purified protein was taken as control ...
-
bioRxiv - Biophysics 2021Quote: ... Purified TREK-2 was then mixed with GUVs to a final concentration of ∼1 - 5 µg/ml and incubated overnight at 4 °C with 0.5mg/ml Bio-Beads (Bio-Rad) prior to use.
-
bioRxiv - Biochemistry 2021Quote: ... The membrane was washed with the washing solution twice and then reacted with 4-chloro-1-naphthol (Bio-Rad Laboratories) in the HRP color development buffer (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: ... Equal amounts of protein (15 μg) were loaded on 4-15% 1 D polyacrylamide Mini-PROTEAN TGX Stain-Free gels (BioRad) and run in 1X Tris Glycine SDS buffer (BioRad ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 µl of prepared sample containing 6.7 µl synaptosome lysate or 1-1.5 µl SV eluate was subjected to SDS-PAGE on 4-20% gradient gels (Criterion TGX, Bio-Rad) and transferred to a PVDF membrane using a semi-dry blotting apparatus ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were spun down at maximum speed for 1 minute and run on precast 4-20% gradient acrylamide gels (BioRad) in 1X Tris-Glycine buffer containing 0.1% SDS ...
-
bioRxiv - Microbiology 2024Quote: ... 7.5 mg of proteins was diluted in ChIP buffer supplemented with 0.01% SDS and precleared for 1 hr at 4°C with 50 μl of SureBeads Protein A Magnetic Beads (BioRad) and 100 μg bovine serum albumin (BSA) ...
-
bioRxiv - Immunology 2023Quote: The previously obtained plasma (1 µl) and gut mucus (30 µl) were separated on a 4-15% Mini-PROTEAN TGX gel (BioRad) under non-reducing conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Binding was performed with gentle mixing for 1 hour at 4°C and loaded onto a Poly Prep Chromatography Column (BioRad). The loaded resin was then washed 3-4 times with 6 ml Wash Buffer (50 mM sodium phosphate ...
-
bioRxiv - Biochemistry 2023Quote: ... was added to the reactions and the products were separated on 4% polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1, Bio-Rad) in TAE (40 mM Tris ...
-
bioRxiv - Plant Biology 2023Quote: Shoot apices of reporter lines were dissected and fixed in 4% paraformaldehyde for 1 hour and embedded in 7% ultra low range agarose gel (BioRad). Fifty µm sections were prepared using a vibratome DTK-1000 (Dosaka ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were stained with primary antibody in blocking buffer at 4°C overnight: anti-NP (1:5000, OBT1555, Bio-Rad), anti-PA ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNA was diluted 1:4 and 4.3 µL of cDNA was mixed with 5 µL iTaq Universal SYBR Green Supermix (BioRad 1725124) and 0.7 µL of 5 µM forward and reverse qPCR primers targeting the gene of interest (333 nM final primer concentration ...
-
bioRxiv - Neuroscience 2024Quote: ... Brain sections were then incubated in primary antibodies at 4°C overnight (1:500, rat anti-mouse CD68, Bio-rad Cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... sections were incubated overnight at 4°C with anti-F4/80 antibody (F4/80 antibody | Cl:A3-1, Bio-Rad, USA). Endogenous peroxidases were quenched by incubating the sections in 3% hydrogen peroxide (Acros Organics ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Microbiology 2022Quote: ... Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was detected by using a 1:1,000 anti-GAPDH hFAB™ Rhodamine antibody (Bio-Rad, Hercules, CA) in 5% milk TBST (Tris buffer saline plus Tween-20) ...
-
bioRxiv - Microbiology 2022Quote: ... 300 nM concentration of each primer targeting the viral DNA substrate (5’- AGCGTGGGCGGGAAAATCTC-3’) and the indicated target DNA (table 1) and 1X iTaq Universal SYBR Green Supermix (Bio-Rad Laboratories). The qPCR cycling conditions for quantifying INS activity included an initial incubation at 95°C for 3 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... The PVDF membrane was then washed 3 × 10 min with TBST and incubated with horseradish peroxidase (HRP)-conjugated goat anti-mouse (diluted 1:20,000; Bio-Rad, Hercules, CA) secondary antibody for one hour at room temperature followed by 6 × 10 min washes with TBST and detection using the Radiance Plus chemiluminescence substrate (Azure Biosystems ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were blocked using 5% BSA in PBS and incubated overnight at 4 °C with 1 or an appropriate combination of up to 3 of the following antibodies: rat anti-CD8 (1:500, catalog no. MCA609G; Bio-Rad Laboratories), rat anti-CD4 (1:1,000 ...
-
bioRxiv - Biochemistry 2024Quote: ... were annealed at a ratio of 3:1 molar ratio Incubated at 93°C for 3 minutes and slowly cooling down in C1000 Touch™ Thermal Cycler (Bio-Rad). The pre-annealed RNA-TS (32 µM ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were prepared for gel electrophoresis by adding a volume containing 20 ug protein to 3 uL 1 M DTT and 7.5 μL 4X Laemmli sample buffer (BioRad Cat. No. 1610747) and topping up to 30 μL with deionized water ...
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ // Reverse: 5’-CGA AGG TGT GAC TTC CAT G-3’) and CFX96 Touch Real-Time PCR Detection System (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...