Labshake search
Citations for Bio-Rad :
101 - 150 of 7089 citations for 1 6 Chloropyridazin 3 yl piperidine 4 carboxamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... for 1–3 hours at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 hours ...
-
bioRxiv - Microbiology 2024Quote: ... lysates were collected and mixed 3:1 with 4x Laemmli sample buffer (Bio-Rad 1610747). Samples were heated at 95°C for 10 min and then separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2024Quote: ... Membrane was washed 3 times and incubated with secondary peroxidase antibodies (1:1000, Bio-RAD) 1 hour in TBS-Tween 1% ...
-
bioRxiv - Microbiology 2023Quote: ... 6’,-diamidino-2-phenylindole (DAPI; BIO-RAD) at room temperature for 30 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... thaliana (5’-CAGGCGGTGGAAACTACCAAG-3’ and 5’-TACAGCACTGCACGGGTCGAT-3’) and R129_E (5’-CGAGCTAATCTCCAAAAGCCATC-3’ and 5’-TGACCCTACCGTGGTTAGCTG-3’) with iQ SYBR Green Supermix (BIO-RAD), as described previously (Garrido-Oter et al. ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Immunology 2023Quote: ... Primary antibody staining was performed overnight at 4&C using rabbit anti-mouse Iba-1 (1:500; Wako Chemical Cat #019-19741) and CD68 (1:200; Bio-Rad Cat #MCA1957) with secondary staining performed for 45 minutes RT using Alexa Flour 594 donkey anti-rabbit (1:400 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were mixed 1:4 with 4X Laemmli buffer (Bio-Rad, Lunteren, Netherlands) containing 10% (v/v ...
-
bioRxiv - Genomics 2024Quote: ... and counted (1:4 dilution) with TC20 Automated Cell Counter (Bio-rad cat. #1450102). Cells were fixed using Parse Biosciences’ Nuclei Fixation Kit v1 (Parse Biosciences cat ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Cell Biology 2024Quote: ... for 1 h at 4°C using the Mini Trans-Blot Cell (Bio-Rad). After the transfer ...
-
bioRxiv - Bioengineering 2023Quote: ... This step was repeated for 3 times and the samples were concentration-matched at OD500nm = 10 and mixed 1:1 with 2x Laemmli buffer (Bio-Rad), containing SDS and 2-mercaptoethanol ...
-
bioRxiv - Genetics 2023Quote: ... followed by purification and size selection on 1% agarose gel with .6 µg/mL ethidium bromide (BioRad Cat#1610433), selecting for the 7,961 bp band ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 x 10^6 cells were electroporated with RNPs in Gene Pulser electroporation buffer (#1652676, Bio-Rad, Hercules, CA) with electroporation enhancer (#1075915 ...
-
bioRxiv - Microbiology 2021Quote: ... pulse times 6-36 s at 6 V/cm on a Bio-Rad CHEF MAPPER apparatus (Bio-Rad Laboratories). Restriction profiles were analyzed using the BioNumerics version 7.10 finger-printing software.
-
bioRxiv - Cell Biology 2021Quote: ... 2-3 μg of total protein were loaded onto 10% SDS-polyacrylamide (29:1 Bio-Rad) gels with 10 μM phostag reagent (FUJIFILM Wako Chemicals ...
-
bioRxiv - Molecular Biology 2020Quote: ... Normalised samples (1 – 3 µg) were electrophoresed on 12% Mini-Protean TGX Stain-Free gels (BioRad) or 4-20% Criterion TGX Stain-Free Precast gels (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... 10% glycerol) then boiled with 1/3 volume of 4x Laemmli sample buffer (Bio-Rad, 1610747) for 10 mins ...
-
bioRxiv - Biochemistry 2023Quote: ... expression media samples were diluted with 2X reducing SDS sample buffer at 1:1 ratio and the mixture was loaded on a 10-well 4–20% SDS-PAGE gradient gel (BioRad). Image J software was used to quantify the signal compared to the negative control (mock transfected culture) ...
-
bioRxiv - Cancer Biology 2024Quote: ... WHO°3 n=3) using the Bio-Plex Cell Lysis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... and then buffer exchanged into 150 mM ammonium acetate pH 7.5 by two consecutive passes over centrifugal gel filtration columns (Micro Bio-Spin P-6, 6-kDa cut off; BioRad). Protein concentration was verified by A280 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4-15% Tris-HCI 4 SDS-PAGE gels (Bio-Rad), separated at 120V ...
-
bioRxiv - Cell Biology 2021Quote: ... Membranes were blocked with 6% milk (BioRad 1706404) in Tris buffered saline (TBS ...
-
bioRxiv - Biophysics 2020Quote: ... or Micro Bio-Spin 6 columns (Bio-Rad)) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2020Quote: ... The extracts were separated on 6% polyacrylamide (Biorad) gel and transferred onto nitrocellulose membranes in Tris/glycine transfer buffer ...
-
bioRxiv - Biochemistry 2021Quote: ... 6 mL gravity flow columns were from Biorad, Germany.
-
bioRxiv - Systems Biology 2024Quote: ... or QuantStudio 6 Flex systems (Bio-Rad Laboratories).
-
bioRxiv - Cell Biology 2020Quote: ... gossypii proteins) or TBS (S. cerevisiae proteins) supplemented with 1 mM DTT using pre-equilibrated BioSpin-6 spin columns (BioRad) or ...
-
bioRxiv - Cancer Biology 2024Quote: Protein lysates were generated by sonicating and boiling 1*10^6 cells in 100ul of 2X Laemmli Buffer (Bio-Rad) with BME ...
-
bioRxiv - Genetics 2024Quote: ... was added to the reactions and the products were separated on 6% polyacrylamide gels (ratio acrylamide:bisacrylamide 19:1, Bio-Rad) in TAE (40mM Tris ...
-
bioRxiv - Biochemistry 2024Quote: ... 4-20% (BioRad), or 6% (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was 1:4 diluted in water and mixed with SYBR® Green (Bio-Rad) and the appropriate primers at 5µM ...
-
bioRxiv - Biophysics 2020Quote: ... Color Development was obtained using the chromogenic substrate 4-chloro-1-naphthol (4CN, Bio-Rad) and H2O2.
-
bioRxiv - Plant Biology 2023Quote: ... for 1 h at 4 °C and incubated with protein-G magnetic beads (Bio-rad) for 0.5 h at 4 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples were resolved 1 cm into a 4-20% precast TGX gel (Biorad, 4561093), stained ...
-
bioRxiv - Genomics 2024Quote: ... then embedded in an acrylamide gel (4% v/v 19:1 acrylamide:bis-acrylamide (Bio-Rad), 300 mM NaCl ...
-
bioRxiv - Microbiology 2020Quote: ... boiled and electrophoresed on 12% vol vol−1 and 4% vol vol−1 acrylamide SDS-PAGE gels (Bio-Rad Laboratories, Canada) on MiniProtean® camera (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2021Quote: ... All slides were subsequently blocked with 4% BSA and 1% Triton X-100 in PBS and incubated with rat anti-CD68 (1:500; Bio-Rad) and mouse-anti-GFP conjugated to Alexa Fluor 488 (1:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... at 1-4 °C and 100 volts for 1 h using Criterion™ blotter with wire electrodes (BioRad, Cat#1704071, USA). Blots were rinsed with phosphate-buffered saline (PBS) ...
-
bioRxiv - Neuroscience 2024Quote: ... Reverse transcription reactions were performed using 4 µL of iScript at room temperature with 1 µg-1 pg of RNA template (Bio-Rad) in a final volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: Surface Plasmon Resonance (SPR) binding experiments were carried out on a ProteOn XPR36 6×6 channels protein interaction array system (Bio-Rad). Proteins BRD4-BD1 an BRD4-BD2 were diluted to a final concentration of 50μg/ml in HEPES buffer 25 mM pH 7.0 and immobilized to a GLM chip using amine coupling ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µl of ion exchange-purified phage was added to 4 µl of cells and after 5 min of incubation mixed 1:2 (v/v) with 6 nm BSA-gold tracers (Aurion) which were transferred to RCV by Micro Bio-Spin® 6 columns (Biorad). Four µl of the mixture were applied onto glow-discharged Quantifoil® R2/1 200 mesh copper grids ...
-
bioRxiv - Cell Biology 2023Quote: ... for 3 hours followed by 20 μM Nigericin for 3 hours (ICT9146, Bio-Rad).
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... The deamination reaction was then carried out by incubating in a thermal cycler for four cycles of 5 minutes at 70°C followed by 1 hour at 60°C and then desalted with Micro Bio-spin 6 chromatography columns (Bio-Rad). RNA was desulphonated by adding an equal volume of 1 M Tris (pH 9.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... as previously described 58 and a custom Bio-Rad 6-plex based on the Human Inflammation Panel 1 (BioRad, Cat# 171AL001M). For both assays ...
-
bioRxiv - Biochemistry 2022Quote: ... and purified by vertical gel electrophoresis on a 6% (60:1 Acrylamide/Bisacrylamide) native gel column using a 491 Prep Cell (Bio-rad) run at 10W and 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1-20 μg of total protein was resolved on a 4-20% polyacrylamide gel (BioRad, 4561096) at 100 V for 60-90 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... Table 1) was performed at 4°C overnight at a 1:1000 dilution in 5% nonfat dry milk (Bio-Rad No. 1706404). Incubation of HRP conjugated secondary antibody (different species ...