Labshake search
Citations for Bio-Rad :
2701 - 2750 of 8863 citations for 7 Bromo 3 4 dihydro 1H benzo e 1 4 diazepine 2 5 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... The gels were then fixed in 12% trichloroacetic acid for 1h and stained with QC Colloidal Coomassie stain (BioRad). Molecular weights were estimated using a calibration curve (Log10 MW vs Rf ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-tubulin YL1/2 (dilution 1:50; Biorad) and guinea-pig anti-Ana1 (dilution 1:500 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’KI and 3’KI as detailed (Fig 2A and D) with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). Briefly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reactions were then mixed with 10 pmol of GRIA2 forward primer (5’ GGGATTTTTAATAGTCTCTGGTTTTCCTTGGG 3’) and reverse primer and 1X iTaq Universal SYBR Green Supermix (BioRad). qPCR was monitored with a Roche Lightcycler 96 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... R primer: 5′-GTACCACCATGTACCCAGGC-3’) cDNA were amplified using the iScript RT-PCR iQ SYBR Green Supermix (BIORAD, Cat.:# 170882) in a qPCR detection system (LightCycler LC480 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10-15 μg of protein samples and 3-5 μL of Precision Plus Protein Dual Color Standards (BIO-RAD, #1610374) were loaded in NuPAGE 4-12% Bis-Tris protein gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were resolved on native acrylamide gels containing 0.5X TBE buffer and 7% acrylamide (made from a stock of 40% acrylamide with a ratio of 29:1 acrylamide:bisacrylamide; Bio-Rad). The running buffer for the gels was 1XTBE ...
-
bioRxiv - Bioengineering 2019Quote: Native PAGE gels were prepared as follows: a fresh solution comprising of polyacrylamide (19:1) at final concentrations from 7 to 13% (Biorad), 0.5x TBE buffer (45 mM Tris-borate ...
-
bioRxiv - Cell Biology 2023Quote: ... phosphorylated in vitro by PLK-1 or CyclinB-Cdk1 as described (7) were separated on stain Free SDS-PAGE 10% gel (Biorad). The gel was imaged and then transferred to a PVDF membrane 0.45 µm during 1h30 at 90V ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plates were incubated at the adequate temperature during 2-3 days and photographed with the Chemiluminiscent Imager (Bio-Rad). For methyl methanesulfonate (MMS ...
-
bioRxiv - Microbiology 2020Quote: ... Two microgram of concentrated viruses were resolved on 4-20% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gels (Biorad) using the Novex™ Sharp Pre-stained Protein Standard (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... Samples were cooled briefly and loaded onto 4-20% pre-cast gels (Bio-Rad Mini-PROTEAN TGX Gels Cat# 4561095) and run at 100-120V using the Bio-Rad Mini-PROTEAN Tetra System ...
-
bioRxiv - Systems Biology 2020Quote: ... Immunoblotting was performed using SDS-PAGE with 12.5% acrylamide or 4-15% gradient gels (Bio-Rad, Cat #4561046, Cat #4561086).
-
bioRxiv - Cell Biology 2020Quote: Samples were resolved on Mini-Protean® TGX 4–20% gels or TGX 7.5% gels (BioRad Laboratories, 4568095 and 4568025). Separated proteins were transferred to Trans-Blot Turbo 0.2-μm PVDF membranes (BioRad ...
-
bioRxiv - Cell Biology 2020Quote: ... In short: OCT is removed with PBS and then tissue is placed in a cold 4% polyacrylamide (1610140 Bio-Rad) hydrogel with 0.25% photoinitiator (VA-044 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lyophilized proteins were dissolved in SDS-PAGE sample buffer and resolved by SDS-PAGE (BioRad precast 4-15 % gradient gel). The gel was stained with Simple Blue Safe Stain (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein extracts were resolved on 4-15% Criterion™ Tris-HCl precast gels (#3450029, Bio-Rad Laboratories, CA, USA) and blotted onto PVDF membranes (#1704157 ...
-
bioRxiv - Cell Biology 2020Quote: ... The lysate was cleared at 12 000 rpm for 10 min at 4°C and protein concentration adjusted with Bradford assay (BioRad). The caspase-3/7 activity of the lysates or the plated cells was analysed using Apo-ONE ® Homogenous Caspase-3/7 Assay (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... Fractions of 1 ml were recovered from the top to the bottom of each tubes and loaded on a gradient 4-12 % SDS-PAGE Bis-Tris gel (BioRad). For Western Blot analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were prepared for mass spectrometry by disrupting total or immunopurified ribosomes in 1X Laemmli buffer and running on a 4-20% Mini-PROTEAN TGX Precast Protein Gel in 1X Tris/Glycine/SDS buffer (BioRad) for 5 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.1 OD equivalents of the resulting sample was subjected to SDS-PAGE and the proteins were separated on 4-15% Mini-PROTEAN-TGX strain-free gels (BioRad). For subsequent immuno-blotting ...
-
bioRxiv - Molecular Biology 2021Quote: ... 25 μg of total protein extracts were run on a gradient (15-4%) Polyacrylamide gel (MINIi-PROTEAN TGX Precast Gels, Biorad). Proteins were transferred on nitro-cellulose membrane and checked with Red Ponceau staining for efficient transfer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Octamers were visualized using 18% separating (4% stacking) discontinuous Laemmli SDS-PAGE in Mini-Protean gel running system (Bio-Rad) run for 70 minutes at 22mA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The supernatant was collected for BCA assay and analyzed by SDS-PAGE using Mini-Protean® TGXTM 4– 15% (BioRad) and transferred to nitrocellulose membranes ...
-
bioRxiv - Developmental Biology 2021Quote: ... separated by SDS-PGE on a 4-15% Mini-PROTEAN® TGX Stain-Free™ gel (Bio-Rad #456-8084), and transferred with the Trans-Blot® Turbo™ RTA Transfer Kit (Bio-Rad #170-4275 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Proteins were separated on 4-20% SDS electrophoresis gel and transferred onto PVDF membranes using Trans-Blot Turbo Transfer System (#1704156, Biorad). Images were acquired using Chemidoc Imaging system (Biorad ...
-
bioRxiv - Neuroscience 2022Quote: ... and equal amount of proteins were separated by SDS/PAGE on pre-cast 4-20% polyacrylamide gradient gels (Cat# 5671094, Biorad) and transferred to immune-blot PVDF membrane (Merck cat# IPVH00010) ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were resolved by gel electrophoresis on a 4 to 20% polyacrylamide gradient Mini-Protean TGX precast gel (Bio-Rad) and transferred to an Immobilon-P membrane (Millipore) ...
-
bioRxiv - Genetics 2022Quote: ... from individuals with DMBT1 size isoform I-IV phenotypes were separated by electrophoresis on 4-15% gradient SDS-PAGE gels (BioRad) and subjected to Western blot-like binding of biotinylated bacteria ...
-
bioRxiv - Molecular Biology 2020Quote: ... About 80 µg of denatured proteins were loaded for each condition and separated on gradient 4–12% polyacrylamide classic or TGX Stain-Free pre-cast gels (Biorad) and transferred onto nitrocellulose membrane (Biorad) ...
-
bioRxiv - Molecular Biology 2020Quote: Whole flies or human primary cell pellet was homogenised in 2x Laemmli loading sample buffer (100 mM Tris pH 6.8, 20% glycerol, 4% SDS; Bio-Rad) containing 50 mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were heated at 60°C and loaded on Mini-Protean TGX precast gels (456–1084, 4-15 %, Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... Lysates were cleared by centrifugation at 14,000×g for 30 min at 4°C and equalized using quick start Bradford 1x dye reagent (BioRad, 5000205). Ni-NTA resin was washed three times with lysis buffer containing 20mM imidazole pH 8.0 and 5mM β-mercaptoethanol while samples were prepared ...
-
bioRxiv - Cell Biology 2022Quote: ... using the BioRad transfer system at 100 V for 60 min at 4°C or with Trans-Blot Turbo Mini PVDF Transfer Packs using Trans-Blot Turbo Transfer System (Biorad). The membrane was blocked for 30 min with the Odyssey Blocking Buffer (TBS ...
-
bioRxiv - Cell Biology 2022Quote: ... supernatants aspirated and loaded on to 4-12% NuPage Bis/Tris gels for separation before transfer on to a Nitrocellulose membrane (Biorad) at 4°C at a constant current of 350mA in transfer buffer (25 mM Tris ...
-
bioRxiv - Immunology 2021Quote: ... were separated on a 4-20% SDS-PAGE gel and blotted onto a PVDF membrane using a Trans-Blot Turbo transfer system (BioRad). Membranes were blocked for 1h in 5% skim milk in TBST and then probed with an anti-S2 mouse monoclonal antibody (GeneTex ...
-
bioRxiv - Cell Biology 2019Quote: ... Polyacrylamide gels used in this study were either prepared using 10% EZ-Run protein gel solution (Fisher) or precast gradient gels (4-20%, from Biorad). Any quantification performed on western blots was done using ImageJ software ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples (15 μL) were loaded onto pre-casted gradient (4-15%) SDS-polyacrylamide gels (Bio-Rad Laboratories; Hercules, CA, USA) and subjected to electrophoresis at 180 V for 60 minutes using pre-made 1x SDS-PAGE running buffer (Ameresco ...
-
bioRxiv - Plant Biology 2019Quote: Proteins were separated on denaturing SDS-PAGE followed by an electrotransfer at 4 °C onto a PVDF membrane (0.2 µM, Bio-Rad). NRT2.1 was detected using three different anti-NRT2.1 antisera produced by Eurogentec against either the synthetic peptide TLEKAGEVAKDKFGK (anti-NRT2.1 19) ...
-
bioRxiv - Genetics 2020Quote: ... Samples were centrifuged at 17,000 × g for 30 min at 4 ºC and the supernatant was run on a 10% Mini-PROTEAN TGX precast polyacrylamide gel (BioRad). Protein was transferred to a PVDF membrane using the iBlot 2 (Life Technologies) ...
-
Weak Membrane Interactions Allow Rheb to Activate mTORC1 Signaling Without Major Lysosome EnrichmentbioRxiv - Cell Biology 2019Quote: ... Immunoblotting was performed with 4-15% gradient Mini-PROTEAN TGX precast polyacrylamide gels and nitrocellulose membranes (Bio-Rad, Hercules, CA). Membranes were blocked with 5% milk in TBS with 0.1% Tween 20 (TBST ...
-
Inhibition of nucleotide synthesis promotes replicative senescence of human mammary epithelial cellsbioRxiv - Systems Biology 2019Quote: ... Whole-cell lysates were resolved by SDS–PAGE on 4– 15% gradient gels and blotted onto nitrocellulose membranes (Bio-Rad). Membranes were blocked for 1 h ...
-
bioRxiv - Systems Biology 2019Quote: ... Whole-cell lysates were resolved by SDS–PAGE on 4–15% gradient gels and blotted onto nitrocellulose membranes (Bio-Rad). Membranes were blocked for 1 h and then incubated with primary overnight and secondary antibodies for 2 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... Samples were boiled at 95 °C for 10 mins with 6×SDS sample buffer before loading onto 4–20% Tris-glycine gels (BioRad). Resolved proteins were transferred to nitrocellulose membranes using the Trans-Blot® Turbo system (BioRad ...
-
bioRxiv - Systems Biology 2019Quote: ... Whole-cell lysates were resolved by SDS–PAGE on 4–15% gradient gels and blotted onto nitrocellulose membranes (Bio-Rad). Membranes were blocked for 1 h in nonfat-milk ...
-
bioRxiv - Biophysics 2021Quote: ... The lysate was centrifuged at 30,000 x g for 30 min at 4°C before being loaded into a gravity flow column (Bio-Rad) and purified by Ni-NTA resin (UBP Bio ...
-
bioRxiv - Genetics 2021Quote: ... rotated at 4°C for 2h and then poured into a Econo-Column® Chromatography column (Bio-Rad, Hercules, CA). After extensive washing first with 80 mL of 20 mM Tris HCl [pH8@4°C] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Samples were run on a 4–20% SDS-PAGE and electroblotted onto a polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories) using a semidry blotting apparatus (Bio-Rad Laboratories) ...
-
bioRxiv - Genomics 2020Quote: 20 μg of protein extracts in Laemmli buffer were run on a 4-20% gradient pre-cast gel (Bio-Rad) and transferred to nitrocellulose using Turbo transfer packs (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The testicular extract was run on a SDS-PAGE 4-15% mini-protean TGX precast gel (Bio-Rad, 456-1084) and transferred to a nitrocellulose membrane ...