Labshake search
Citations for Bio-Rad :
201 - 250 of 9795 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... at 4°C (Bioruptor Pico, BioRad). Then ...
-
bioRxiv - Cancer Biology 2023Quote: 4–20% polyacrylamide gels (Bio-Rad) were used for protein separation ...
-
bioRxiv - Immunology 2023Quote: ... 4-12% Tris-HCl (Bio-Rad) with XT MOPS running buffer (Bio-Rad) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-15% gel (Bio-Rad, #4568086). Transfer and Western Blotting was performed as described above ...
-
bioRxiv - Cell Biology 2024Quote: ... 4× Laemmli sample loading buffer (BioRad) was added to the supernatant and the mixture was boiled for 5 mins at 95 °C ...
-
bioRxiv - Microbiology 2024Quote: ... or 4-20% gradient gels (BioRad). Coomassie blue was used to stain gels with recombinant proteins ...
-
bioRxiv - Genetics 2024Quote: ... 4×Laemmli Sample Buffer (Bio-Rad) was added to lysates and samples were denatured at 50°C for 15min (and not boiled to prevent the aggregation of the DMT1 transmembrane protein) ...
-
bioRxiv - Microbiology 2024Quote: ... and 0.25µM of each 5’ 6-FAM/ZEN/3’ IBFQ or 5’ HEX/ZEN/3’ IBFQ probe with the QX200 Droplet Digital PCR System (Biorad). Reactions were performed using the following PCR cycle settings ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membrane was then incubated overnight at 4°C with a 1:1000 concentration of anti-6×His tagged monoclonal antibody produced in mouse (ABD Serotec Biorad, UK). Then ...
-
bioRxiv - Genetics 2021Quote: ... Forty micrograms of total protein from hippocampal nuclear lysates was boiled for 5-minutes to dissociate complexes before separation in a 4-20% gradient gel (Bio-Rad 4561096) for 1-hour at 150V in 1x Tris/Glycine/SDS (Bio-Rad 1610732) ...
-
bioRxiv - Cell Biology 2022Quote: Protein homogenates (5 or 15 μg/lane) were size fractionated on 4–15% or 15% Criterion TGX gels (Biorad Laboratories, Oslo, Norway) and transferred to 0.45 μM PVDF-membranes (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2020Quote: ... To reduce non-specific binding single cell suspensions were incubated for 5 min at 4°C with PBS/10% AB-serum (Bio-Rad, Germany), subsequently stained with fluorescence-labeled or biotinylated antibodies for 15 min at 4°C and washed once with PBS/2% FCS/0.01% NaN3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein-containing lysates of exosomes (5 μg) were run on a 4–20% Mini-PROTEIN TGX gel (Bio-Rad, Hercules, California, USA) and transferred to a nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were heated to 95°C for 5 min and then analyzed on a 4-12% gel (Bio-Rad Laboratories, Hercules, CA) using SDS running buffer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 1-5 μg of purified antigen or 20 μg protein extract were loaded in a precast 4-20% acrylamide gel (BioRad 456-1094). Gels were run for the first 20-30 min at 40V ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples are prepared for SDS-PAGE by adding 5 μl of sample to 4 μl of tricine sample buffer (Bio-Rad 1610739) and 1 μl of 1 M DTT and heat denaturing at 70 °C for 3 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples were prepared for SDS-PAGE by adding 5 μl of sample to 4 μl of tricine sample buffer (Bio-Rad 1610739) and 1 μl of 1 M DTT and heat denaturing at 90 °C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were boiled at 95°C for 5 min and loaded into 4-12% Criterion XT-Bis-Tris polyacrylamide gels (Bio-Rad 3450125). Gel electrophoresis was performed in 1X MES running buffer (Bio-Rad 1610789 ...
-
bioRxiv - Biochemistry 2024Quote: ... and boiled at 95° C for 5 minutes before separation on 4–20% Mini-PROTEAN® TGX™ Precast Protein Gels (BioRad). In-gel fluorescence was imaged first ...
-
bioRxiv - Microbiology 2024Quote: ... protein samples were boiled at 95 °C for 5 min and separated by a 4–20% Mini-PROTEAN® TGX Stain-Free™ SDS PAGE (BioRad) or 12 % Tris-Glycine SDS PAGA (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were separated on 4%-15% or 4%-20% Criterion TGX precast protein gels (64134751; Bio-Rad), and transferred to an Immun-Blot PVDF membrane (1620177 ...
-
bioRxiv - Biochemistry 2024Quote: ... then loaded on 4–15% or 4-20% polyacrylamide Tris-glycine gradient gels (Bio-Rad, Hercules, CA). Following electrophoresis ...
-
bioRxiv - Cell Biology 2021Quote: ... Lysates were diluted 1:4 with Laemmli sample buffer (Bio-Rad), incubated for 95°C (5min) ...
-
bioRxiv - Microbiology 2022Quote: ... centrifuged for 20 minutes at 4°C and supernatants mixed 3:1 with 4x Laemmli sample buffer (Bio-rad 1610747). Samples were heated at 95°C for 5 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates (30 µg) were run approximately one inch into a 4-15% bis-acrylamide gel (Bio-Rad) and processed for in-gel digestion as previously described (60) ...
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Plant Biology 2023Quote: ... and CCD1 (5’-GGGAAGAGGGTGATGAAGTTGT-3’ and 5’-TGATATCCATTCACCTTGTCCAAA-3’) and 5 µl of SsoAdvanced Universal SYBR Green Supermix (172-5270; BioRad, Hercules, CA, USA). All samples were analyzed in triplicate using the CFX connect Real-Time PCR Detection System (1855201 ...
-
bioRxiv - Immunology 2022Quote: ... for 2 hours at 4 °C using Mini-trans blot wet tank transfer (BioRad). After transfer ...
-
bioRxiv - Genetics 2020Quote: ... and ligated to MseI and EcoRI adaptors (Supplementary Table 4) at 37° C for 2 h in a T100™ Thermal cycler (Bio-Rad Laboratories, Hercules, CA). Success of the digestion/ligation reaction was confirmed on 1.5% of agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... and blocked for 1 h with 5% non-fat milk (Bio-Rad Laboratories) or BSA (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2021Quote: ... Membranes were blocked for 1 h with 5% nonfat milk powder (Bio-Rad) in TBS + 0.05% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were rinsed in DBPS and moved to semi-solid media (6:4 ratio of 1% agarose (BIO-RAD, Hercules, CA, USA) in DPBS:DMEM with 10% FBS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein separation was performed on Mini-Protean TGX (4-15% or 4-20%) SDS-PAGE gel (Bio-Rad) and transferred to PVDF membranes (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 were incubated overnight at 4°C and revealed using peroxidase-conjugated antibodies and an ECL kit (BioRad). Images were captured using ChemiDocTM XRS Imaging system (Biorad).
-
bioRxiv - Cell Biology 2023Quote: ... Samples were run on 4-15% or 4-20% Mini-PROTEAN SDS-PAGE gels (Bio-Rad, Hercules, CA) in 1X TGS solution (250 mM tris ...
-
bioRxiv - Cancer Biology 2023Quote: ... All western blots were run using PROTEAN TGX precast 4-15% or 4-20% gradient gels (Bio-Rad) and transferred to either 0.2μm or 0.44μm nitrocellulose membranes ...
-
bioRxiv - Immunology 2022Quote: ... incubated for five days at 4°C in 40 mL of hydrogel monomer solution [4% acrylamide (Bio-Rad), 0.05% bis-acrylamide (Bio-Rad) ...
-
bioRxiv - Physiology 2024Quote: ... Proteins were resolved in 4–20% or 4–15% Mini-PROTEAN TGX gels (BIORAD, 4561093 and 4561083, respectively) and transferred onto TransblotTurbo midi-size nitrocellulose membranes (0.2 μm pore size ...
-
bioRxiv - Systems Biology 2022Quote: ... sample buffer (5 minutes at 95°C) and subjected to gel electrophoresis (4– 15% Criterion™ TGX™ Precast Midi Protein Gel, Bio-Rad) and immunoblotting (polyvinylidene difluoride Transfer Membrane ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples were heated at 95°C for 5 min prior to loading onto 4-20% Mini-PROTEAN® TGX™precast polyacrylamide gel (Bio-Rad). Gel electrophoresis was done at 100 V for 90 min ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Samples were heated at 95°C for 5 min prior to loading onto 4-20% Mini-PROTEAN® TGX™precast polyacrylamide gel (Bio-Rad). Gel electrophoresis was done at 100 V for 90 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were heated 5 min at 95°C and separated on 4-20% Mini-PROTEAN® TGX Stain-Free™ Precast gels (Bio-Rad) or on home-made 7% polyacrylamide gel for OPA1 immunodetection ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the sample incubated at 90°C for 5 min and resolved by electrophoresis through a 4–20% gradient polyacrylamide/SDS gel (Bio-Rad Laboratories, 5671085). Next ...
-
bioRxiv - Neuroscience 2023Quote: ... heated for 5 min at 95°C and loaded onto 4–15% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad, Germany). Proteins were transferred on nitrocellulose membranes and membranes were blocked with 5% BSA in PBS-Tween ...
-
bioRxiv - Bioengineering 2023Quote: ... and boiled at 95 °C for 5 min before loading and running in 4-15% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad, Cat# 4561083) with Precision Plus Protein Dual Color Standards (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... and boiled at 95 °C for 5 min before loading and running in 4-15% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad, Cat# 4561083) with Precision Plus Protein Dual Color Standards (Bio-Rad ...
-
bioRxiv - Neuroscience 2024Quote: ... was then added and the samples were boiled at 95 °C for 5 min before loading and running in 4-15% Mini-PROTEAN TGX Precast Protein Gels (Bio-Rad, Cat# 4561083) with Precision Plus Protein Dual Color Standards (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were boiled at 95°C for 5 min and resolved in 4-20% Mini-PROTEAN® TGX™ Precast Protein Gels (Bio-Rad). Proteins were transferred to a nitrocellulose membrane and probed overnight at 4°C with primary antibodies ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were boiled for 3 minutes and separated on a 4-20% precast polyacrylamide gel (Biorad).
-
bioRxiv - Immunology 2023Quote: Fab (3 μg/lane) was loaded on a 4%-12% Bis-Tris precast gel (Bio-rad) in non-reducing conditions and run at 120 V in 3-Morpholinopropane-1-sulfonic acid (MOPS ...