Labshake search
Citations for Bio-Rad :
151 - 200 of 9795 citations for 5R 3 4 5 6 Tetrahydro 5 phenyl N benzyloxycarbonyl 4 H 1 4 oxazin 2 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... The suspended eggs and siRNA (5 μg/μl stock solution, in MilliQ) were transferred to a 4 mm cuvette (Bio-Rad) with a final volume of 200 μl and were gently mixed ...
-
bioRxiv - Microbiology 2021Quote: ... Binding reactions were incubated for 40 minutes at 37 °C then run on a precast 5% TBE acrylamide gel at 4 °C for 45 minutes at 100 V (Bio-Rad). After transfer to Biodyne B Modified Nylon Membrane (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The second-dimension gel electrophoresis was performed in 1× TBE buffer containing 0.3 μg/ml of ethidium bromide at 6.0 V/cm for 5 hr at 4°C with buffer circulation in a Sub-cell GT electrophoresis system (Bio-Rad). DNA was transferred to Hybond-XL (GE Healthcare).
-
bioRxiv - Microbiology 2021Quote: ... proteins were denaturized in SDS-PAGE protein loading buffer for 5 minutes at 95°C and resolved by SDS-PAGE on 4-12% bis-tris Criterion XT Precast gels (Bio-rad), transferred to a PVDF membrane and blocked for at least 1h in 1% Casein blocking buffer (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: ... against the OAD buffer for 6h at 4 °C to remove the sucrose and then loaded on an EnrichQ 5/50 column (Bio-Rad) equilibrated with the ion-exchange buffer A (50 mM HEPES pH 7.4 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Equal masses of protein (5 ug – 40 ug) were separated by 4—15% of SDS/ PAGE and were transferred onto nitrocellulose membranes (Bio-Rad) for protein blot analysis ...
-
bioRxiv - Biophysics 2022Quote: ... Digestion was confirmed by running 5 µL of digested or diluted samples on a 4-20% TGX Mini-Protean gradient gel (Bio-Rad), followed by staining with Gelcode Blue (Thermo Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were boiled for 5 min at 95°C before separation on a gradient 4 to 20% sodium dodecyl sulfate (SDS)-polyacrylamide gel (Bio-Rad). Samples were then transferred to nitrocellulose membrane using standard methods for semidry transfer (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... at either 95°C for 5 minutes or at 70°C for 10 minutes and resolved in a 4-15% Precast Gels (Bio-Rad, 12-well ...
-
bioRxiv - Microbiology 2024Quote: ... 20µg of protein samples were heated in 1X Laemmli buffer at 95°C for 5 min and loaded on pre-cast 4-20% SDS-polyacrylamide electrophoresis gel (Bio-Rad). For the RIP experiment ...
-
bioRxiv - Plant Biology 2023Quote: ... Protein extractions containing 5 µg of Chl with 1 x SDS loading buffer were boiled at 100℃ for 5 min and loaded onto a 4 - 20% polyacrylamide gel (Mini Protean TGX, Biorad Laboratories). Proteins were transferred to a PVDF-FL membrane on a Biorad semidry blotting system ...
-
bioRxiv - Microbiology 2023Quote: ... boiled for 5 minutes at 95°C and loaded onto Mini-Protean TGX Stain Free Gels 4-20% (Bio-Rad, P4568096). The gels were transferred onto 0.45 μm nitrocellulose membranes (Bio-Rad ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5 μg of protein extracts were run on a 4%–15% polyacrylamide gels (Mini Protein TGX Stain-Free gels, Bio-Rad) and transferred to PVDF (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the samples were boiled for 5 minutes before being loaded on the gel (4-15% Criterion TGX Precast Midi Protein Gel, Bio-Rad). Proteins were separated by SDS-PAGE and blotted into a polyvinylidene fluoride (PVDF ...
-
bioRxiv - Biochemistry 2023Quote: ... The samples were incubated at 95°C for 5 min and 10 μL of the sample was resolved on a 4%–15% Mini-PROTEAN® TGX Precast Gel (Biorad) and stained with Coomassie Blue.
-
bioRxiv - Biochemistry 2023Quote: ... The samples were incubated at 95°C for 5 min and 10 μL of the sample was resolved on a 4%–15% Mini-PROTEAN® TGX Precast Gel (Biorad) and stained with Coomassie blue dye.
-
bioRxiv - Plant Biology 2023Quote: ... and 10 (V/V) % beta-mercaptoethanol for 5 minutes before being loaded into a 4-20% gradient SDS-PAGE gel (Biorad: 4561096) and run according the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and heated to 100 °C for 5 min and resolved on 4-20% (w/v) gradient SDS-PAGE gels (Bio-Rad) with Tris-glycine buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... 20 µl of input and 5 µl of IP samples were loaded and protein samples were separated on 4-20% Tris-glycine polyacrylamide gels (Bio-Rad) at 170 V for 1 hour in 1X Tris/glycine/SDS running buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equal amounts of protein was denatured at 95°C for 5 min in 1x Laemmli buffer containing 5% β-mercaptoethanol and separated in 4-15% mini-PROTEAN TGX Precast Protein Gels (Biorad) by electrophoresis and blotted onto Nitrocellulose membrane (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were denatured by 5 min incubation at 95°C before running them on a TGX 4–12% or 10% gel (Bio-Rad) and transferred onto nitrocellulose membrane for hybridization with specific antibodies.
-
bioRxiv - Immunology 2024Quote: ... were washed with 500 μl ice-cold acetone to remove TCA at 16,000g for 5 min at 4 °C and resuspended in 100 μl 1x XT sample buffer (Bio-Rad #1610791), boiled at 95 °C for 10 min ...
-
bioRxiv - Cell Biology 2024Quote: ... The samples were boiled for 5-10 minutes and then separated using SDS-PAGE with 4-12% Criterion XT Bis-Tris Gels (Bio-Rad). The proteins were transferred to PVDF membranes (Merck Millipore) ...
-
bioRxiv - Cell Biology 2024Quote: ... boiled at 950C for 5 min and loaded into each lane of a 4–15% Mini-PROTEAN TGX Stain-Free precast gel (Bio-Rad). Colour Prestained Protein ladder was loaded in some wells in order to determine the molecular mass of proteins in the experimental samples ...
-
bioRxiv - Neuroscience 2024Quote: ... The membranes were then washed 4 times with PBST and then incubated in the dark for 5 min with Clarity Western ECL substrate (1705060, Bio-Rad), and imaged using the Amersham Imager 600 (GE Industries ...
-
bioRxiv - Plant Biology 2024Quote: ... heat-denatured at 95°C for 5 min and separated by SDS-PAGE on home-made gels or 4-15% precast polyacrylamide gel (Bio-rad).
-
bioRxiv - Neuroscience 2024Quote: ... heated at 95 °C for 5 min and loaded on stain-free 4–15% gradient sodium dodecyl sulfate polyacrylamide gel electrophoresis gels (Bio-Rad). Separated proteins were transferred onto a Polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2024Quote: ... sample protein (5-8 µg) and molecular weight ladders were loaded onto a 4–15% Criterion TGX precast gels (Bio-Rad) for gel electrophoresis separation ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were boiled at 95°C for 5 min and proteins were separated on 4–15% Mini-Protean TGX precast protein gel (Bio-Rad) and transferred onto hydrophobic polyvinylidene fluoride (0.45 μm PVDF ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 μg protein/sample was denatured at 95 °C for 5 min in Laemmli buffer with 2.5% ß-mercaptoethanol and separated with a 4–20% Mini-PROTEAN (Bio-Rad) polyacrylamide gel in 25 mM Tris ...
-
bioRxiv - Genomics 2024Quote: ... the samples were treated with 5% 2-mercaptoethanol in Laemmli buffer and heated at 95°C for 5 minutes prior to loading into a 4-15% gradient SDS gel (Cat# 4568085, Bio-Rad) and run at 160v for 50-55 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were boiled at +90 °C for 5 min prior to protein separation using precast SDS- PAGE gradient gels (4–20% Mini-PROTEAN TGX, Bio-Rad) and transferred onto nitrocellulose membranes with the semi-dry Trans-Blot Turbo Transfer System (Bio-Rad) ...
-
bioRxiv - Biochemistry 2023Quote: ... pre-run for 1 hour at 4 ° C and run for 1 hour at 120 volts on Mini-Protean 3 gels (Bio-Rad).
-
bioRxiv - Genetics 2022Quote: ... reverse 5’ - CACGTGGGACCGCTCGTCTCC) and MUC3B-specific primers (forward 5’ CGGGGGCCAGTGGGATGGCCTCAAG-3’; reverse 5’-CACGCGGGACCGCTCGTCTCT-3’) using SsoFast EvaGreen Supermix (#1725200, Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad ...
-
bioRxiv - Cell Biology 2024Quote: ... and mixed with a one-third volume of 4×Laemmli protein sample buffer (cat. # 1610747, Bio-Rad). Following centrifugation at 20,000×g at 4°C for 10 min ...
-
bioRxiv - Biophysics 2024Quote: ... This mixture was then incubated at 4 °C for 1 hour and further subjected to a 4-hour incubation with bio-beads (Bio-Rad, USA). After incubation ...
-
bioRxiv - Bioengineering 2020Quote: ... Membranes were incubated with primary antibodies overnight at 4°C and for 1 h at room temperature (RT) with secondary horseradish peroxidase conjugated antibodies (Bio-Rad, 1:3000). Membranes were then developed using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Biophysics 2022Quote: ... 1 mg of post-thrombin digested claudin-4 in DDM was treated with 4 mg of amphipol (1:4 w/w) for 2 hours before removing detergent via addition of 400 mg SM-2 biobeads (Bio-Rad). Excess cCpE was added to each claudin-4 sample at a molar ratio of 1:1.5 ...
-
bioRxiv - Microbiology 2020Quote: ... Clarified lysates were incubated with 2 ml of glutathione resin and rotated for 1 h at 4°C in a 25 ml disposable drip column (Bio-Rad). Settled resin was washed with 25 column volumes (CV ...
-
bioRxiv - Biochemistry 2021Quote: ... The supernatant was incubated for 1 h at 4°C with 0.5 mL Profinity IMAC resin (Bio-Rad Laboratories, Hercules, CA) in a buffer containing 20 mM MOPS-Na (pH 7.4) ...
-
bioRxiv - Bioengineering 2023Quote: ... Equal amounts of the proteins (50 µg) were electrophoresed (125 volts, 1 h) on a 4-20% Mini protean TGX stain-free protein gel (Bio-Rad) and transferred onto nitrocellulose membranes (125 volts ...
-
bioRxiv - Molecular Biology 2022Quote: ... and incubated for 1 h with 5% blotting grade blocker (Bio-Rad). Primary antibodies were incubated overnight at 4℃ and secondary HRP-conjugated antibodies were incubated for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... After 1 h blocking (5% non-fat milk, Bio-Rad 170–6404) at room temperature (RT) ...
-
bioRxiv - Plant Biology 2021Quote: ... membranes were washed 3 times 5 min with washing solution and incubated 1 h with anti-rabbit IgG HRP-conjugated secondary antibodies (Bio-Rad, 1:3000) at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... the mix contained 4% acrylamide (BioRad), 0.03% BisAcrylamide (BioRad) ...
-
bioRxiv - Cell Biology 2020Quote: ... precast 4-18% gradient gels (BioRad). Recombinant N-terminally acetylated α- ...
-
bioRxiv - Cell Biology 2022Quote: ... 4%-20% gradient gels (Bio-Rad) were used for Sml1 blots and 4%-15% gradient gels (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 4× Laemmli Sample Buffer (Bio-Rad) was added and samples were run in SDS-PAGE without extra elution steps ...
-
bioRxiv - Biochemistry 2020Quote: ... 4–20% gradient gels (Bio-Rad), and protein bands were visualized with Coomassie Brilliant Blue (Bio-Rad ...
-
bioRxiv - Genetics 2021Quote: ... 4% goat/donkey serum (Bio-Rad Laboratories ...