Labshake search
Citations for Bio-Rad :
2301 - 2350 of 5277 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and 5% beta-mercaptoethanol (Bio-Rad, Hercules, CA) and separated by SDS-PAGE with NuPAGE 4-12% Bis-Tris 1.5 mm 15-well gels (Thermo Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... IL-7 (5 ng/mL; BioRad, Paris France), and IL-2 (10 ng/mL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 5 μl of 4X Laemmli loading dye (BioRad) was added to 15 μl of either total lysate ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl of 4X loading buffer (Bio-Rad) was added ...
-
bioRxiv - Neuroscience 2022Quote: ... and blocked in 5% Blotting Grade Blotter (Biorad) diluted in Tris buffered saline (TBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of SYBR Green Supermix (Bio-Rad), and 2 μl of cDNA (100 ng/mL) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5% (w/v) NFDM (Biorad, cat no: 1706404) blocking was also performed for each antibody ...
-
bioRxiv - Immunology 2024Quote: ... 72°C for 5 minutes (BioRad, Hercules, CA). Genomic PCR was performed using the following primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% Serva Blue G dye (Bio-Rad) in 1M aminocaproic acid/50mM Bis–Tris/HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... blocked in 5% non-fat milk (Bio-Rad) in TBST and incubated in primary antibodies (1:5000 rabbit anti-GFP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Non-denaturing 5% polyacrylamide 1xTBE Criterion gels (BioRad) were pre-run 30 minutes before loading the reactions.
-
bioRxiv - Biochemistry 2022Quote: ... with ImageLab Version 5 (Bio-Rad, Hercules, CA). Each experiment has three independent repeats.
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of Sosofast Eva Green (Bio-Rad) 2X master mix ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 µl precision melt supermix (Bio-Rad, Germany) and 1 µl DNA was used for real-time PCR ...
-
bioRxiv - Immunology 2024Quote: ... then blocked with 5% blocking protein (Bio-Rad) for 1.5h at 37°C and washed four times again ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μL of SYBR Green mix (Bio-Rad) and 0.9 μL of RNase-DNase free water (Promega ...
-
bioRxiv - Immunology 2022Quote: ... and mouse hypoxanthine-guanine phosphoribosyltransferase gene (Hprt) (forward, 5’-GGACTTGAATCAAGTTTGTG-3’; reverse, 5’-CAGATGTTTCCAAACTCAAC-3’) in a CFX96 Real-Time PCR Detection System (Bio-Rad). The qRT-PCR results were analyzed using the ΔCt method (relative expression ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes were washed three times with 1X PBS for 5 min and developed with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate in alkaline phosphatase buffer (Bio-Rad).
-
bioRxiv - Microbiology 2023Quote: ... US28 (sense, 5’-CCAGAATCGTTGCGGTGTCTCAGT-3’; antisense, 5’-CGTGTCCACAAACAGCGTCAGGT-3’) and GAPDH were detected with CFX Connect Real Time System (Bio-Rad) using iTaq Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Microbiology 2023Quote: ... and primer set previously described [25] CtPl+ 5’-TAGTAACTGCCACTTCATCA-3’ and CtP2 5’-TTCCCCTTGTAATTCGTTGC-3’) and using a CFX96TM real-time thermocycler (Bio-Rad)) ...
-
bioRxiv - Biophysics 2022Quote: ... After boiling the beads at 95°C for 5 min in 2X Laemmli sample buffer with 5% β-mercaptoethanol (Bio-Rad), the immunoprecipitated protein was resolved on 10% SDS-PAGE gels and then transferred onto 0.45 μm PVDF membrane (GE ...
-
bioRxiv - Neuroscience 2023Quote: ... Membranes were washed 5 X 5 min in TBST and signals were detected using the Clarity Western ECL Substrate (Biorad #1705060). At least 2 separate gels were immunoblotted with cortical extracts from independent litters and used for quantitation.
-
bioRxiv - Microbiology 2022Quote: ... qPCR was performed by mixing 5 μl of 5-times diluted cDNA with 10 μl of iTaq Universal SYBR Green mix (Bio-Rad), 3.6 μl of water and 0.8 μl of forward and reverse primers listed in Supplementary Table 1 ...
-
Self-assembled DNA-collagen bioactive scaffolds promote cellular uptake and neuronal differentiationbioRxiv - Bioengineering 2024Quote: ... The macrostructure was assembled by heating the primers at 95 °C for 30 min and then cooling them to 5 °C with a step decrease of 5 °C every 15 min using a PCR instrument (BioRad, USA). The resulting macrostructure was then stored at 4 °C until required ...
-
bioRxiv - Molecular Biology 2024Quote: ... The RNA primers for PMS2 (5’ATAACGTGAGCTCCCCAGAA; 5’ GAGGACCAGGCAATCTTTGA) and ACTIN (5’GGCTGTATTCCCCTCCATCG; CCAGTTGGTAACAATGCCATGT) were used to amplify target mRNA using iTaq Universal SYBR Green (Biorad, 1725120) and quantified on (Biorad CRX Connect Real-Time PCR Detection System ...
-
bioRxiv - Immunology 2024Quote: ... from colonic samples of DR3.IL17A-/- (n = 5) and DR3 mice (n = 5) were reverse transcribed to cDNA using the High-Capacity iScript cDNA synthesis kit (Bio-Rad). qPCR reactions were then carried out in triplicate using 50 ng of cDNA and the Applied Biosystems Power SYBR Green PCR Master Mix (Applied Biosystems) ...
-
bioRxiv - Immunology 2024Quote: Organoids and Mode-K cells were incubated at 37°C with 5% CO₂ in culture media supplemented with 5 µg/mL PureBlu Hoechst (Bio-Rad) and 5 µg/mL Propidium Iodide ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were then washed five times in 5% TBST (5 minutes each) and incubated with goat anti-mouse IgG secondary antibody (PCS 1706516, Bio-Rad) at a 1:3000 dilution in 5% milk powder in TBST for 1 hour at room temperature ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: ... after 1 min UV-induced photoactivation with Gel Doc EZ Imager (Bio-Rad). Proteins were then transferred onto a nitrocellulose membrane ...
-
bioRxiv - Genetics 2021Quote: ... and 1) the SsoAdvanced™ Universal SYBR® Green Supermix (1725274; Bio-Rad) with oligonucleotide primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Developmental Biology 2021Quote: ... sheep anti-GFP (1:1000 AbD Serotec/Bio-Rad Cat# 4745–1051, RRID:AB_619712); rabbit anti-RFP (1:500 Abcam Cat# ab62341 ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were diluted 1:10 in water and mixed with iTaq (Bio-Rad), with analysis carried out on a Bio-Rad CFX96 Touch instrument ...
-
bioRxiv - Microbiology 2020Quote: ... 2.5kV cm-1 in a Gene Pulser apparatus (BIO-RAD, Hercules, CA, USA). Cell recovery was performed in ice-cold super optimal broth with catabolite repression media (SOC ...
-
bioRxiv - Molecular Biology 2021Quote: The optimum reaction contained 1× ddPCR SuperMix for Probes (no dUTP) (Bio-Rad), 900 nM forward primer ...
-
bioRxiv - Molecular Biology 2021Quote: Plugs were loaded on a gel containing 1% agarose (Bio-Rad Cat. 1620138) in 0.5x TBE (45 mM Tris ...
-
bioRxiv - Neuroscience 2021Quote: ... Secondary antibodies were goat anti-rabbit HRP (1:5000, Bio-Rad: 170-5046) and goat anti-mouse HRP (1:5000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were blocked in 1x Tris Buffered Saline (TBS) with 1% Casein (BioRad) for 1 h at room temperature followed by overnight incubation at 4 °C with primary antibodies diluted in blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Blots densitometric analyses were performed using Quantity One 1-D software (Bio-Rad) and compared with that made by MCID.
-
bioRxiv - Microbiology 2021Quote: ... PCR products were visualized on 1% agarose gel (Bio-Rad Laboratories, Hercules, CA) containing SYBR Safe (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were visualized on 1% agarose gel (Bio-Rad Laboratories, Hercules, CA) containing SYBR Safe (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... Substrates were annealed at a 1.2:1 primer:template ratio in a thermocycler (BioRad) by incubation for 10 minutes at 95 oC ...
-
bioRxiv - Bioengineering 2020Quote: ... Samples were incubated with the primary antibodies (1:100 dilution; CD68, Bio-Rad, Cat# MCA1957 ...
-
bioRxiv - Neuroscience 2020Quote: ... To obtain sparse astrocyte labelling we used 1 μm gold particles (Bio-Rad) and followed a standard protocol (Benediktsson et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and a secondary antibody (goat anti-rabbit HRP, Bio-Rad, AB_11125142; 1:2,000) were used in these experiments.
-
bioRxiv - Cell Biology 2021Quote: ... for detecting HIV-1 reverse transcription or iQ SYBR Green Supermix (Bio-Rad) for detecting actin.
-
bioRxiv - Physiology 2020Quote: ... rabbit polyclonal anti-Cytochrome C (Cyt C) (AHP2302, Bio-Rad Laboratories, 1:500), mouse monoclonal anti-MMP2 (sc-13595 ...
-
bioRxiv - Microbiology 2020Quote: ... at 1:10,000 followed by development with Clarity Western ECL Substrate (Bio-rad) and imaging on a Chemidoc XRS Imaging System (Bio-rad).
-
bioRxiv - Molecular Biology 2020Quote: ... or Goat-anti-Mouse IgG (1:1000, 170-6516, Bio-Rad, CA, USA) for 2 hours at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... quenched by 1 M HCl and read at 450 nm (BioRad iMark, USA). The total protein per sample was determined via the BCA protein assay standards kit (Biorad ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 µg reversely transcribed into cDNA (iScript cDNA synthesis kit, Bio-Rad). Gene expression was assessed from 10 ng cDNA at the ABI 7900 HT system using SYBR green detection and the SDS (v2.4 ...