Labshake search
Citations for Bio-Rad :
2251 - 2300 of 5277 citations for 1 2 Dihydro 1 2 tetrahydro 2H pyran 2 yl oxy ethyl 5H tetrazole 5 thione d4 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... goat anti-mouse IgG (H + L)-HRP conjugate (Biorad 1706516; 1:2500), AffiniPure goat anti-rabbit IgG (H + L)-HRP conjugate (Jackson ImmunoResearch ...
-
bioRxiv - Biochemistry 2023Quote: ... or anti-rabbit HRP-antibodies (dilution 1 to 3000, #1706515, Bio-Rad).
-
bioRxiv - Molecular Biology 2023Quote: ... 1:5000) and blots analyzed by ChemiDoc MP fluorescence imaging (Biorad, 12003154). Images were processed using Image Lab software (BioRad).
-
bioRxiv - Microbiology 2023Quote: HIV-1/O RNA was quantified on a CFX96 Deep-Well (BioRad) by targeting integrase O thanks to primers and TaqMan probe ...
-
bioRxiv - Genetics 2023Quote: ... see table 1) using the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). The qPCR program used was 94 °C 15 min ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Collagen-Type IV (Collagen-IV) (Bio-RAD, 2150-1470, 1:400) and anti-VEGF164 (R&D Systems ...
-
bioRxiv - Immunology 2023Quote: ... Horseradish peroxidase (HRP)-conjugated goat anti-rabbit (1:2000, Bio-Rad, #1706515) secondary antibody was used ...
-
bioRxiv - Microbiology 2023Quote: ... HRP-conjugated anti-mouse IgG and anti-rabbit IgG (1:3000, Biorad) were used and imaged using the imaged using Azure 600 gel imaging system (Azure Biosystems).
-
bioRxiv - Immunology 2023Quote: ... 100 µl/ well of protein G-HRP conjugate (1:3000, Bio-Rad) in PBS was added and incubated for 1 hr at 37°C and then washed with PBST ...
-
bioRxiv - Biophysics 2024Quote: ... the following components were mixed: 1 mL of 40% bisacrylamide (BioRad, 161040), 325 μl of 2% acrylamide (BioRad ...
-
bioRxiv - Microbiology 2024Quote: ... at 1:1000 and a Strep-tag classic mouse monoclonal antibody (Biorad) at 1:500 ...
-
bioRxiv - Physiology 2024Quote: ... using the Quantity One 1-D Analysis software (Bio-Rad, Hercules, CA). All protein data has been normalized to loading control and total protein expression by quantifying the total protein in the entire lane ...
-
bioRxiv - Molecular Biology 2024Quote: ... The His::STL-1 was purified using Nuvia IMAC column (Bio-Rad) in the presence of washing buffer (20 mM HEPES ...
-
bioRxiv - Biochemistry 2024Quote: Isolated mitochondria or mitoplasts were lysed with 1× Laemmli buffer (Bio-Rad,) with β-mercaptoethanol ...
-
bioRxiv - Systems Biology 2024Quote: ... hFAB™ rhodamine conjugated anti-GAPDH antibody (1:2000; Bio-Rad #12004168); mouse anti-PSD95 monoclonal antibody(1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Secondary antibodies diluted 1:5000 (anti-rabbit Starbright 700 (12004161, Bio-Rad) for specific tardigrade proteins and anti-mouse Starbright 520 (12005867 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a rat anti-CD68 antibody (1:100; Bio-Rad, Cat #MCA1957) overnight at 4°C followed by corresponding Alexa Fluor 488- and Alexa Fluor 594-conjugated secondary antibodies (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... and goat anti-mouse IgG HRP (1:3000; Bio-Rad, California, USA). Proteins were detected using an enhanced chemiluminescent detection system (Clarity Western ECL Substrate ...
-
bioRxiv - Microbiology 2024Quote: ... anti-GAPDH hFAB™ Rhodamine (Bio-Rad, catalogue no. 12004167, 1:2500), anti-Tubulin hFAB™ Rhodamine (Bio-Rad ...
-
bioRxiv - Microbiology 2024Quote: ... anti-Tubulin hFAB™ Rhodamine (Bio-Rad, catalogue no. 12004165, 1:2500).
-
bioRxiv - Pathology 2024Quote: ... and rat anti-F4/80 (1:50; MCA497, Bio-Rad; CA, USA), and the secondary antibodies were Alexa Fluor 633-conjugated anti-rabbit (1:200 ...
-
bioRxiv - Microbiology 2024Quote: ... proteins were transferred to polyvinylidene fluoride (PVDF; Bio-Rad, 1, 620, 177) membranes ...
-
bioRxiv - Neuroscience 2024Quote: ... and goat anti-mouse HRP conjugate (1:10,000, #170-6516, Bio-Rad). The blots were developed using SuperSignal west Femto substrate (Thermo Fischer).
-
bioRxiv - Immunology 2024Quote: ... and 1 µl reverse transcriptase (iScript cDNA Synthesis kit, 1708891, Bio-Rad) in RNase-free water to obtain a total volume of 20 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... blot was incubated in anti-mouse StarbrightBlue 700 (BioRad #12004158, 1:2500), anti-rabbit DyLight 800-conjugated secondary antibody (Cell Signaling Technology ...
-
bioRxiv - Neuroscience 2024Quote: ... rat anti-mouse CD68 (Bio-Rad, MCA1957; clone FA-11, 1/200), rat anti-mouse CD138 (BD Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... The gel was made using Pulsed Field Certified Agarose (1%, Bio-Rad) in 0.5X TBE ...
-
bioRxiv - Biochemistry 2024Quote: ... The PCR products were run on a 1% agarose gel (Biorad #1613100EDU) and cleaned using the Wizard@ SV Gel and PCR Clean-Up System A9281 ...
-
bioRxiv - Microbiology 2024Quote: ... the plugs were transferred to a 1% Certified Megabase agarose (Bio-Rad) gel in 0.5X TBE buffer (Fisher BioReagents™ ...
-
bioRxiv - Immunology 2024Quote: ... Boil the washed beads with 1× Laemmli sample buffer (1610747; Bio-Rad) to elute the bound proteins ...
-
bioRxiv - Immunology 2024Quote: ... F4/80 (PE-F4/80, Catalog#MCA497, clone Cl:A3-1, Bio-Rad) and isotype controls ...
-
bioRxiv - Cell Biology 2024Quote: ... and goat anti-rabbit IgG HRP conjugate (BioRad 170– 6515, 1:5000). The secondary antibody used to detect B56α ...
-
bioRxiv - Biophysics 2024Quote: ... equilibrated in buffer 1 on an NGC system (Bio-Rad, Hercules, CA) running Chromlab 6.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Membrane was blocked for 1 hour at room temperature with TBS (BioRad) supplemented with 0.1% Tween-20 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... was used at a 1:3000 dilution and the secondary antibodies (BioRad) were used at a 1:2000 dilution ...
-
bioRxiv - Biochemistry 2024Quote: ... the monoclonal anti-mouse CD68 was from Bio-rad (1:500, #MCA1957). Fibrillar Aβ (plaque core ...
-
bioRxiv - Biochemistry 2024Quote: ... 1 mM DTT) using an automated NGC chromatography system (Bio-Rad Laboratories).
-
bioRxiv - Evolutionary Biology 2021Quote: ... gene expression was normalized with the housekeeping gene Act5c (primers: 5’ –gcgcccttactctttcacca-3’ and 5’ - atgtcacggacgatttcacg-3’. We performed the RT-qPCR analysis with SYBR Green (BioRad) or qPCRBIO SyGreen Blue Mix LO-ROX (PCR BIOSYSTEMS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... were cultured regularly in DMEM supplemented with 10% FBS (and 5% penicillin and streptomycinat 37°C with 5% CO2 34,35. Transfection was performed by electroporation using the Bio-Rad Gene Pulser Xcell system ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 5 times with 0.1% Tween-20 5 minutes each then imaged using ChemiDoc Imaging system (BIO-RAD).
-
bioRxiv - Immunology 2023Quote: ... 5’ GACGTGGGCTCCTTACACTGA 3’)(41) and 18s (Fwd: 5’ CTTAGAGGGACAAGTGGCG 3’, Rev: 5’ ACGCTGAGCCAGTCAGTGTA 3’)(42) using the SsoFast assay system (BioRad) was used to quantify transcripts in a BioRad CFX94 machine.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 μl of mixed primers containing 5 μM of each primer (forward and reverse) and 5 µl of iTaq Universal SYBR Green Supermix (BioRad) in a final volume of 10 μl ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 μl of mixed primers containing 5 μM of each primer and 5 μl of iTaq Universal SYBR Green Supermix (BioRad), as previously described (Xavier et al. ...
-
bioRxiv - Genomics 2024Quote: To investigate the presence of SRY in Brutus a PCR using primers specific for canine SRY (Forward: 5’ AAGGCCACGGCACAGAAAAGTCAC and Reverse: 5’ AAGAAGCGTCAGCGGACATCTGTG from (19) was performed using iProof HF Master Mix (BioRAD). Amplification was carried out in 25 μL reactions with 1 × PCR MasterMix ...
-
bioRxiv - Cancer Biology 2022Quote: ... PVDF membranes were blocked with 5% milk (BioRad) in TBST and then probed with listed antibodies diluted in either 1% BSA (anti-phospho-specific antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... Membranes were blocked in 5%-milk (Biorad 1706404) for 30 minutes and washed in PBS/Tween20-0.05% ...
-
bioRxiv - Neuroscience 2022Quote: ... After being blocked in 5% milk (Bio-Rad), the membrane was incubated with primary anti-tau polyclonal antibody (Dako ...
-
bioRxiv - Genomics 2022Quote: ... and 5 kbp ladder (BioRad,Cat #170–3624) were used as standards ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-tetramethylbenzidine (TMB Peroxidase EIA Substrate Kit, Biorad), a stop solution (H2SO4 2M ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA extractions using a 5% Chelex (Bio-Rad Laboratories ...