Labshake search
Citations for Bio-Rad :
2101 - 2150 of 4536 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... and reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad, 1708890). Quantitative real-time RT-PCR analysis was performed using SYBR Green (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were measured using the BCA protein assay kit (Bio-Rad Laboratories, Inc.). Electrophoresis was performed using 30 μg of protein lysates ...
-
bioRxiv - Pathology 2023Quote: ... and cDNA synthesized from 1μg RNA with iScript cDNA synthesis kits (Bio-Rad 1708891). Quantitative PCR was performed using iQ SYBR Green super mix (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized from total RNA with the iScript cDNA synthesis kit (Bio-Rad) and qPCR was carried out with the SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Physiology 2023Quote: ... and converted to cDNA using an iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). qPCR was performed on a Bio-Rad CFX96 qPCR Detection System using a reaction mix containing Bio-Rad 2x SYBR Green Master Mix ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracted RNA was used for cDNA synthesis using iScript cDNA Synthesis kit (BIO-RAD) in accordance with manufacturer’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... Generation of cDNA was performed using the iScript cDNA synthesis kit (BioRad cat# 1708890), reverse transcribing 1 μg of RNA per reaction ...
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using a standard Bradford Colorimetric Assay kit (Bio-Rad, 5000116).
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA was prepared by following manufacture’s instruction (iScript select cDNA synthesis kit, BioRad). The GNL primers (GTTTGGAGA CAATGATGGCGT/TCCCGTTCCAGCGAGAGTAAC ...
-
bioRxiv - Developmental Biology 2024Quote: ... Conversion into cDNA was performed using reverse transcription (iScript cDNA Synthesis Kit; Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were determined by DC Protein Assay kit (Bio-Rad; Hercules, CA, USA) according to manufacturer protocol ...
-
bioRxiv - Molecular Biology 2022Quote: 1µg of purified RNA was reverse transcribed using iScript cDNA synthesis Kit (BioRad, #1708891). For secondary structure sensitive reverse transcription reactions (Figure 2E and F) ...
-
bioRxiv - Molecular Biology 2022Quote: ... purification and cDNAs were synthesized with iScript™ cDNA synthesis kit (1708841, Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... One microgram RNA was reverse-transcribed using an IScript cDNA synthesis kit (Bio-Rad). Reverse transcription PCR (RT-PCR ...
-
bioRxiv - Physiology 2022Quote: It was performed using the kit iScriptTM cDNA synthesis (Bio-Rad, cat. no 1708890). 500 ng of RNA were mixed with 2 µl of 5X iScript Reaction Mix and 0.5 µl of the enzyme iScript Reverse transcriptase in a volume of 10 µl ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cDNA synthesis was done by iScript™ cDNA Synthesis kit (Cat #1708891, BIO-RAD) in each condition ...
-
bioRxiv - Cell Biology 2024Quote: ... whose concentrations were measured using the DC Protein Assay Kit (Lowry method, BioRad, 5000116), following the instructions provided by the manufacturer.
-
bioRxiv - Neuroscience 2024Quote: ... cDNA synthesis was performed using the iScript cDNA Synthesis kit (Bio-Rad, #170-8891). qRT-PCR was performed in triplicate on a CFX384 Real Time System C1000 Thermal Cycler (Bio-rad ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was generated from 1ug RNA using iScript reverse transcription kit (Bio-Rad, #1708891) and diluted 1:3 in water ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNA synthesis was then performed using reverse transcription kits (Bio-Rad Laboratories, Hercules, CA). qPCR was carried out with TaqMan® probe/primers (Applied Biosystems ...
-
bioRxiv - Neuroscience 2024Quote: ... The complementary DNA was synthesized using iScript cDNA synthesis kit (Bio-Rad, #1708891, USA), according to the manufacturers’ protocol ...
-
bioRxiv - Bioengineering 2024Quote: ... Protein concentrations were determined by Bradford protein assay reagent kit (BIO-RAD, Hercules, CA). Visible GFP bands in the Comassie Blue Stained protein gels were quantified with 1D-Multi lane densitometry (Alpha Innotech Alphaimager 2200 ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were revealed using an enhanced chemiluminescence kit (1705061 Bio-Rad, Hercules, California, USA) and the imaging system LAS-4000 mini (GE HealthCare Technologies Inc. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Reverse transcription was performed with iScript™ Advanced cDNA Synthesis Kit (BioRad, NSW, Australia) and the PCR was performed with PrimePCR SYBR® Green Assays (BioRad ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentration was measured using a RC-DC kit (Biorad Lab., Hercules, CA, USA) according to the manufacturing protocol ...
-
bioRxiv - Immunology 2024Quote: RNA from 5×10^6 splenocytes was extracted with the RNeasy Mini Kit (BioRad) and converted to cDNA using the Maxima First Strand cDNA Synthesis Kit (ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... supernatant was retained and protein quantified with the DC Protein assay kit II (Biorad). Proteins samples (1.5µg and 3µg of proteins ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
Genomic dissection and mutation-specific target discovery for breast cancer PIK3CA hotspot mutationsbioRxiv - Genomics 2024Quote: ... RNA was converted to cDNA using the iScript cDNA Synthesis Kit (Bio-rad, 1708890). qPCR was performed using the AREG and ACTB qPCR primer sets (Table S5 ...
-
bioRxiv - Cell Biology 2024Quote: ... Total RNA was reverse transcribed to cDNA using the iScript Advanced cDNA kit (Biorad) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... treated with Turbo DNase and converted to cDNA using iScript cDNA synthesis kit (BioRad). Gene expression was quantified using iTaq Universal SYBR Green (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: cDNA was prepared with the help of iScript gDNA clear cDNA synthesis kit (Biorad). cDNA was added to iTaq Universal SYBR Green Supermix and gene specific primers ...
-
bioRxiv - Immunology 2023Quote: ... Protein concentrations were determined and normalized using the DCA Protein Assay kit (Bio-Rad). Clarified lysates (5 min × 5,000 g ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... and reverse-transcribed into cDNAs using cDNA iScriptTM advanced cDNA synthesis kit (Bio-Rad). Duplex ddPCR reactions were performed by combining cDNA products with human IL-1α ...
-
bioRxiv - Neuroscience 2023Quote: ... using the iTaq™ Universal Probes One-Step Kit for probes (Bio-Rad Laboratories). The samples were run in 384-well formats in triplicates as multiplexed reactions with a normalizing internal control ...
-
bioRxiv - Pathology 2023Quote: ... RNA was transcribed into cDNA using the iScript cDNA synthesis kit (BioRad, Hercules, CA). The cDNA was used for RT-qPCR with qPCRBIO SyGreen Blue mix Hi-ROX (PCR Biosystems ...
-
Mitigating a TDP-43 proteinopathy by targeting ataxin-2 using RNA-targeting CRISPR effector proteinsbioRxiv - Bioengineering 2023Quote: ... and converted to complementary DNA (cDNA) using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturers’ instructions ...
-
bioRxiv - Physiology 2023Quote: ... and reverse transcribed into cDNA using the iScript cDNA synthesis kit (1708891, Bio-Rad). QRT-PCR was used to assess the levels of transcripts with gene-specific primers (Table 1) ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by cDNA preparation using the BioRad iScript cDNA Synthesis kit (BioRad; Cat #:1708891). cDNA was subsequently purified with AMPure XP beads (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was reverse-transcribed into cDNA using iScript cDNA Synthesis Kit (Bio-Rad; 1708891). GoTaq quantitative PCR (qPCR ...
-
bioRxiv - Neuroscience 2024Quote: ... 200ng of totalRNA sample was reverse transcribed with iScript cDNA synthesis kit (Bio-Rad) and quantitative PCR (q-PCR ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA (1 μg) was reverse transcribed using iScript™ cDNA Synthesis Kit (Bio-Rad), and PCR was performed using Q5® High-Fidelity 2X Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA was retrotranscribed into cDNA using the iScript™ cDNA synthesis kit (BioRad, 1708891). PCR was performed using Phusion Universal qPCR Kit (Life Tech ...
-
bioRxiv - Neuroscience 2023Quote: ... Protein concentrations were determined using the Bradford Protein Assay kit (Bio-Rad, Hercules, CA). Proteins were separated by electrophoresis on 4-20% SDS-PAGE gels (Bio-Rad ...
-
bioRxiv - Molecular Biology 2023Quote: ... were collected and protein concentration was determined using DC Protein assay kit (Bio-Rad).
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated using the iScript™ cDNA Synthesis Kit (Bio-Rad #1708890, USA) following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... treated and converted to cDNA using the iScript™ cDNA Synthesis Kit (Bio-Rad). Primers for LmTERT (target ...
-
bioRxiv - Cell Biology 2023Quote: ... 500 ng RNA was reverse transcribed using the iScript cDNA Synthesis Kit (Bio-Rad) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and immediately converted to complementary DNA (cDNA) using an iScript cDNA Synthesis Kit (BioRad). qPCR was conducted on a 96-well plate using 30 ng of cDNA with TaqMan Fast Advanced Master Mix (ThermoFisher Scientific ...