Labshake search
Citations for Bio-Rad :
2051 - 2100 of 4536 citations for Human Procollagen Type III N Terminal Propeptide PIIINP ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A family of contact-dependent nuclease effectors contain an exchangeable, species-identifying domainbioRxiv - Microbiology 2020Quote: ... and finally developed using Immun-Star HRP substrate kit (Bio-Rad Laboratories, Hercules, CA). Blots were visualized using a Chemidoc (Bio-Rad Laboratories ...
-
bioRxiv - Physiology 2020Quote: ... 500ng mRNA was used for cDNA synthesis using the iScript kit (Bio-Rad, 1708891). Quantitative PCR was performed in triplicate 25 μL reactions using 2X SYBR Green SuperMix (PerfeCTa ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was synthesized using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA, USA). Finally ...
-
bioRxiv - Cell Biology 2020Quote: ... Reverse transcription was carried out using an iScript™ cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed using the iQ™ SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... the membrane was visualized using the ECL Western Blotting Detection Kit (Bio-Rad, USA).
-
bioRxiv - Genomics 2021Quote: ... refer to the SureCell ATAC-Seq Library Prep Kit User Guide (17004620, Bio-Rad). Tagmented cells were loaded onto a ddSEQ Single-Cell Isolator (12004336 ...
-
bioRxiv - Microbiology 2021Quote: ... The autoradiography signals were visualized using ECL advance Western blotting detection kit (BioRad, USA).
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using the iScript™ Reverse Transcription Supermix kit (Bio-Rad, #1708841).
-
bioRxiv - Physiology 2021Quote: ... Protein concentration in the lysates was estimated using Dc protein assay kit (Bio-Rad). The lysates (30 μg ...
-
bioRxiv - Neuroscience 2020Quote: ... and retro-transcribed into cDNA by iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Inc) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using the iTaq Universal SYBR Green One-Step Kit (Bio-Rad, Hercules, CA, USA) and primers listed in Table 1 ...
-
bioRxiv - Plant Biology 2020Quote: ... Total protein of the samples was quantified using a Protein DC kit (Bio-Rad). β-Mercaptoethanol and loading dye was added to 125 µg of the samples ...
-
bioRxiv - Immunology 2020Quote: Reverse transcription of RNA was performed utilizing iScript cDNA Synthesis Kit (Bio-Rad Laboratories) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized with iScript™ cDNA Synthesis Kit (#170-8891 from Bio-Rad). qPCR was performed using KAPA SYBR® Fast and primers for ITGB1 (5’AGATCCGAAGTTTCAAGGGC3’ and 5’GAACCATGACCTCGTTGTTC3’) ...
-
bioRxiv - Developmental Biology 2021Quote: ... the RNA was reverse transcribed (RT) using the iScript cDNA synthesis kit (Bio-Rad) in a final volume of 10 μl ...
-
bioRxiv - Neuroscience 2021Quote: ... Retrotranscription (RT) reactions were performed using the iScript cDNA Synthesis kit (Biorad PN170-8891) following manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Purified sfGFP was measured using a Quick Start Bradford Kit (BioRad, Hercules, CA, USA) in biological triplicate and technical triplicate.
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated by using the Aurum total RNA mini kit (Bio-Rad) and treated with DNase (Bio-Rad ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA was reverse transcribed using iScript™ cDNA Synthesis Kit (BioRad, Hercules, CA, USA). One hundred nanograms of cDNA were amplified in duplicates in each 40-cycle reaction using a CFX 384 Real Time PCR System (BioRad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were determined using the Bradford Protein Assay Kit (Bio-Rad, Hercules,CA). Equal amounts of protein were separated on 4-12% NuPAGE SDS gel (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... Total protein concentration was measured using a DC Protein Assay kit (Bio-Rad Laboratories) and 40μg of protein lysate per sample was loaded on 4-20% polyacrylamide gels (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... using iScript™ Reverse Transcription supermix for RT-qPCR kit (BIO-RAD Laboratories, USA) following manufacturer’s instructions at PCR conditions (priming at 25°C for 5min ...
-
bioRxiv - Microbiology 2020Quote: ... The iScript cDNA synthesis kit was used for reverse transcription (Biorad, Hercules, CA, USA). iTaq FAST SYBR Green Supermix with ROX (Biorad ...
-
bioRxiv - Neuroscience 2021Quote: Reverse transcription was carried out using iScript cDNA synthesis kit (170-8891, Bio-Rad) for mRNA targets and TaqMan Advanced miRNA cDNA synthesis kit (ThermoFischer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Synthesis of cDNA was accomplished using the iScriptTM cDNA Synthesis Kit (Bio-Rad®), and 1000 ng of RNA was used as the input for the cDNA synthesis of each sample ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated using the iScript cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, California) and qRT-PCR reactions were run on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... the reactivity of the colonies was detected using the Opti-4CN Substrate Kit (BIORAD), according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... and used for reverse transcription with the iScript™cDNA synthesis kit (Bio-rad, Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... cDNA was synthesized using oligo-dT primers and iScript cDNA synthesis kit (BioRad, 1708891). Reverse transcription-quantitative Polymerase Chain Reaction (RT-qPCR ...
-
bioRxiv - Neuroscience 2023Quote: ... and 1000ng RNA was used for cDNA synthesis with the Iscript kit (Bio-Rad) as described previously (19).
-
bioRxiv - Physiology 2023Quote: ... Protein concentrations were determined using the DC Protein Assay Kit II (#5000112, Bio-Rad). Proteins (20μg ...
-
bioRxiv - Biochemistry 2022Quote: ... The total protein level was estimated by using the Bradford assay kit (Bio-Rad). 30 µg of total cellular proteins from the individual samples were subjected to SDS-PAGE ...
-
bioRxiv - Immunology 2023Quote: ... and cDNA was synthesized per kit instructions (iScript cDNA Synthesis, Bio-Rad, Hercules, CA). All primers were from Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the bound proteins were detected with the ClarityTM Western ECL kit (Bio-Rad Laboratories).
-
bioRxiv - Microbiology 2023Quote: ... Protein concentrations were determined using DC Protein Assay Kit (Bio-Rad; Hercules, CA, USA). Proteins were separated by SDS-PAGE and were blotted onto an Amersham™ Protran® nitrocellulose membrane (Merck KGaA ...
-
bioRxiv - Microbiology 2023Quote: ... following either random priming or gene specific primers by iScript cDNA synthesis kit (BioRad). 20 μL of cDNA reaction is diluted 5 times before the quantitative PCR reaction ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted and transcribed to cDNA with a reverse transcription kit (Bio-Rad). Quantitative real-time PCR reactions were performed using SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... Extracted RNA was converted to cDNA with an iScript cDNA Synthesis Kit (Bio-Rad), followed by qPCR reactions using SYBR Select Master Mix (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA was synthesized using an iScript-cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). iTaq Universal SYBR Green Supermixes (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... or ddPCR using One-Step RT ddPCR Advanced Kit for Probes (Bio-Rad 1864022). Copy numbers were calculated with a regression curve from control RNA transcript standards and normalization to per µg RNA in cortex or per ml CSF ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR reactions were assembled using the ddPCR Supermix for Probes (No dUTP) kit (BioRad). Each ddPCR reaction contained 1 µl cDNA and either Dbh and Tbp or Th and Tbp probes (250 nM each ...
-
bioRxiv - Immunology 2022Quote: ... and cDNA was synthesized using the iScript cDNA synthesis kit (Bio-Rad, Hercules CA) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA quality was determined by a bioanalyzer (Biorad, RNA Stdsense kit, Hercules, CA, USA). The RNA was reverse transcribed to cDNA with a SuperScript IV VILO kit (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... MRNA was reverse transcribed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). Q-PCR was performed on a CFX-Connect Real Time PCR Detection System using SYBR Green Master Mix reagent (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... Complementary DNA was synthesized from RNA using an iScript cDNA Synthesis Kit (Bio-Rad). qPCR was run with PowerUP SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2023Quote: ... The complementary DNA (cDNA) was prepared using iScript™ cDNA Synthesis Kit (Bio-rad) as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 500 ng of RNA was converted to cDNA using iScript cDNA synthesis kit (BioRad). For Taqman real-time PCR analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA synthesis was performed using the iScript Reverse Transcriptase Supermix kit (BioRad, Cat# 1708841) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... qRT-PCR was carried out using iScript RT Supermix (BioRad cDNA kit, cart#1708841) and iTaq Universal SYBY green Supermix kit (BioRad cat# 1725121 ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was reverse-transcribed by using iScript TM cDNA synthesis Kit (Bio-Rad) in a volume of 20 μL ...